ID: 1075446676

View in Genome Browser
Species Human (GRCh38)
Location 10:122518198-122518220
Sequence TCAGCTCCCTGGTTGAGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075446665_1075446676 22 Left 1075446665 10:122518153-122518175 CCCTGACCTTCTGATGAGGTCCC No data
Right 1075446676 10:122518198-122518220 TCAGCTCCCTGGTTGAGTCCGGG No data
1075446666_1075446676 21 Left 1075446666 10:122518154-122518176 CCTGACCTTCTGATGAGGTCCCT No data
Right 1075446676 10:122518198-122518220 TCAGCTCCCTGGTTGAGTCCGGG No data
1075446667_1075446676 16 Left 1075446667 10:122518159-122518181 CCTTCTGATGAGGTCCCTGCTCT No data
Right 1075446676 10:122518198-122518220 TCAGCTCCCTGGTTGAGTCCGGG No data
1075446672_1075446676 1 Left 1075446672 10:122518174-122518196 CCTGCTCTGGGTGTGTGTCCGGC No data
Right 1075446676 10:122518198-122518220 TCAGCTCCCTGGTTGAGTCCGGG No data
1075446670_1075446676 2 Left 1075446670 10:122518173-122518195 CCCTGCTCTGGGTGTGTGTCCGG No data
Right 1075446676 10:122518198-122518220 TCAGCTCCCTGGTTGAGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075446676 Original CRISPR TCAGCTCCCTGGTTGAGTCC GGG Intergenic