ID: 1075448194

View in Genome Browser
Species Human (GRCh38)
Location 10:122528461-122528483
Sequence GAGGATGAACATAATGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075448194_1075448202 24 Left 1075448194 10:122528461-122528483 CCCTCACCATTATGTTCATCCTC No data
Right 1075448202 10:122528508-122528530 TAGATGATAAATTCCTGCTGGGG No data
1075448194_1075448200 22 Left 1075448194 10:122528461-122528483 CCCTCACCATTATGTTCATCCTC No data
Right 1075448200 10:122528506-122528528 ACTAGATGATAAATTCCTGCTGG No data
1075448194_1075448201 23 Left 1075448194 10:122528461-122528483 CCCTCACCATTATGTTCATCCTC No data
Right 1075448201 10:122528507-122528529 CTAGATGATAAATTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075448194 Original CRISPR GAGGATGAACATAATGGTGA GGG (reversed) Intergenic
No off target data available for this crispr