ID: 1075451083

View in Genome Browser
Species Human (GRCh38)
Location 10:122552453-122552475
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075451083_1075451092 21 Left 1075451083 10:122552453-122552475 CCTAGCTAGAGGCTGTGCCATGG No data
Right 1075451092 10:122552497-122552519 ACACTGGGGTTGCCACTGAAGGG No data
1075451083_1075451089 6 Left 1075451083 10:122552453-122552475 CCTAGCTAGAGGCTGTGCCATGG No data
Right 1075451089 10:122552482-122552504 GTCTTCATGTGGAACACACTGGG No data
1075451083_1075451090 7 Left 1075451083 10:122552453-122552475 CCTAGCTAGAGGCTGTGCCATGG No data
Right 1075451090 10:122552483-122552505 TCTTCATGTGGAACACACTGGGG No data
1075451083_1075451087 -5 Left 1075451083 10:122552453-122552475 CCTAGCTAGAGGCTGTGCCATGG No data
Right 1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG No data
1075451083_1075451088 5 Left 1075451083 10:122552453-122552475 CCTAGCTAGAGGCTGTGCCATGG No data
Right 1075451088 10:122552481-122552503 GGTCTTCATGTGGAACACACTGG No data
1075451083_1075451091 20 Left 1075451083 10:122552453-122552475 CCTAGCTAGAGGCTGTGCCATGG No data
Right 1075451091 10:122552496-122552518 CACACTGGGGTTGCCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075451083 Original CRISPR CCATGGCACAGCCTCTAGCT AGG (reversed) Intergenic
No off target data available for this crispr