ID: 1075451087

View in Genome Browser
Species Human (GRCh38)
Location 10:122552471-122552493
Sequence CATGGAGCTCGGTCTTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075451082_1075451087 -4 Left 1075451082 10:122552452-122552474 CCCTAGCTAGAGGCTGTGCCATG No data
Right 1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG No data
1075451079_1075451087 14 Left 1075451079 10:122552434-122552456 CCGGACTGGGACCTGTGGCCCTA No data
Right 1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG No data
1075451083_1075451087 -5 Left 1075451083 10:122552453-122552475 CCTAGCTAGAGGCTGTGCCATGG No data
Right 1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG No data
1075451081_1075451087 3 Left 1075451081 10:122552445-122552467 CCTGTGGCCCTAGCTAGAGGCTG No data
Right 1075451087 10:122552471-122552493 CATGGAGCTCGGTCTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075451087 Original CRISPR CATGGAGCTCGGTCTTCATG TGG Intergenic
No off target data available for this crispr