ID: 1075456377

View in Genome Browser
Species Human (GRCh38)
Location 10:122587650-122587672
Sequence AAACACCCCCAGATGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075456374_1075456377 9 Left 1075456374 10:122587618-122587640 CCTGATTACTATGGGCAGACACA 0: 3
1: 0
2: 1
3: 8
4: 84
Right 1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075456377 Original CRISPR AAACACCCCCAGATGCAGCA GGG Intronic
No off target data available for this crispr