ID: 1075457088

View in Genome Browser
Species Human (GRCh38)
Location 10:122591903-122591925
Sequence ACGTGGTCCTCTCTGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075457088_1075457094 4 Left 1075457088 10:122591903-122591925 CCAGAAGCCAGAGAGGACCACGT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1075457094 10:122591930-122591952 GCCACCAAACTCTTCGACATGGG No data
1075457088_1075457093 3 Left 1075457088 10:122591903-122591925 CCAGAAGCCAGAGAGGACCACGT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1075457093 10:122591929-122591951 TGCCACCAAACTCTTCGACATGG No data
1075457088_1075457096 5 Left 1075457088 10:122591903-122591925 CCAGAAGCCAGAGAGGACCACGT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1075457096 10:122591931-122591953 CCACCAAACTCTTCGACATGGGG No data
1075457088_1075457099 27 Left 1075457088 10:122591903-122591925 CCAGAAGCCAGAGAGGACCACGT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1075457099 10:122591953-122591975 GATAGCATAGGCCTGCCCTCTGG No data
1075457088_1075457098 15 Left 1075457088 10:122591903-122591925 CCAGAAGCCAGAGAGGACCACGT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1075457098 10:122591941-122591963 CTTCGACATGGGGATAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075457088 Original CRISPR ACGTGGTCCTCTCTGGCTTC TGG (reversed) Intronic
900990296 1:6095544-6095566 ACCTGGTCCCCTCTGGCCTGTGG + Exonic
903003637 1:20284008-20284030 AAGAGGTCCTCCCTGGCTTCGGG - Intergenic
903052745 1:20613677-20613699 ACGTGGCCTTCTCAGCCTTCAGG + Intronic
905809530 1:40901985-40902007 CACTGGTCCTCTCTGGCTTTGGG + Intergenic
906444793 1:45886907-45886929 GCCTGGTCCTCCCTGGCCTCAGG + Intronic
908403061 1:63789022-63789044 ACGTGACCTTCTCTGGCATCCGG + Intronic
911247909 1:95539411-95539433 ACGTGCTCCCCTCTGGACTCTGG + Intergenic
914229952 1:145756687-145756709 CCATGATTCTCTCTGGCTTCTGG + Intronic
920900038 1:210100238-210100260 GCATGGTCCTCTCTGGATGCTGG - Exonic
921436037 1:215123331-215123353 AAGTGGTTATCTCTGGATTCTGG + Intronic
922003320 1:221503383-221503405 ACGTTCTCCTCTCTGGGATCTGG - Intergenic
923650173 1:235866644-235866666 GGGGCGTCCTCTCTGGCTTCTGG - Intronic
1063333734 10:5188513-5188535 ACGTGGCCTTCCCTGGCTACAGG - Intergenic
1065278693 10:24112996-24113018 CTGTGCTCCTCTCTTGCTTCTGG - Intronic
1066593138 10:37017717-37017739 ATGTGGCCCTCTCTAGCTGCAGG + Intergenic
1067227873 10:44387007-44387029 ACGCGGGCCTTTCAGGCTTCTGG - Intergenic
1068838549 10:61583841-61583863 ACCTGGTCATCAATGGCTTCAGG + Intergenic
1069639176 10:69943953-69943975 CCGTGATCCTCTTTGGGTTCAGG - Intronic
1069996056 10:72342856-72342878 ACATGGCAGTCTCTGGCTTCAGG - Intronic
1072614899 10:97042911-97042933 ACGTGGCCTTCCCTGACTTCAGG - Exonic
1075455481 10:122582214-122582236 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075456530 10:122588574-122588596 CCATGGTCCTCCCTGGCTTCTGG - Intronic
1075457088 10:122591903-122591925 ACGTGGTCCTCTCTGGCTTCTGG - Intronic
1075457604 10:122594917-122594939 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075458677 10:122601411-122601433 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459308 10:122605470-122605492 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459940 10:122609529-122609551 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075460572 10:122613588-122613610 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075461206 10:122617647-122617669 ACATGGTCCTCTCTGGTTTCTGG - Intronic
1076114252 10:127884489-127884511 ATCTGGTCCTCTCTGGCCCCAGG - Intronic
1077496474 11:2889208-2889230 ACCTAGGCTTCTCTGGCTTCTGG - Intronic
1080851353 11:36072908-36072930 ACCTGGTTGTCACTGGCTTCTGG + Intronic
1081646637 11:44794989-44795011 AGGGGGTCCTCACTGGCTTTAGG + Intronic
1083689245 11:64396806-64396828 ACGTGGACCTCCCTGGGCTCAGG + Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1088019317 11:105100398-105100420 ACTTCCTTCTCTCTGGCTTCAGG - Intronic
1088197968 11:107296573-107296595 ACGTGGTCCTGAATGGCTACTGG + Intergenic
1090224764 11:125063368-125063390 ATGCGGTCCTCCCTGGCTCCGGG + Exonic
1090465474 11:126929550-126929572 ACGTGGTCTTATTTGGCTTTTGG - Intronic
1093699390 12:22201735-22201757 AGGTGGCCATCTATGGCTTCTGG - Exonic
1097181556 12:57174832-57174854 ACATGGTCCTCCCTGACTCCTGG - Intronic
1100148109 12:91701922-91701944 ACCTGATGCTCTCTGGCTTTGGG + Intergenic
1100671392 12:96816834-96816856 CCCTGGTCCACTCTGCCTTCAGG + Intronic
1104496702 12:129247374-129247396 ACTTGTCCCTCTCTGGCTTTAGG + Intronic
1105624169 13:22097010-22097032 CAGTTGTCATCTCTGGCTTCAGG + Intergenic
1107814754 13:44234339-44234361 ACGTGGTTCTCTGTGGCCTCTGG + Intergenic
1112948686 13:104962587-104962609 ACGTGGTTTCCCCTGGCTTCTGG - Intergenic
1114472654 14:22974443-22974465 ATCTGGTCCTCACTGGCTTTTGG + Intronic
1114473874 14:22981263-22981285 AAGTAGTCCTCCCTGGCCTCTGG + Exonic
1114869332 14:26636940-26636962 ACTTTGATCTCTCTGGCTTCTGG - Intergenic
1118766746 14:68915190-68915212 ACGAGGGCCTCTCTGGCCACTGG - Intronic
1119892443 14:78193020-78193042 ACCTGGACCTCTTTGCCTTCTGG - Intergenic
1120209705 14:81622908-81622930 TCGTGGTCTTTGCTGGCTTCAGG + Intergenic
1126886694 15:53158554-53158576 AGATGGTCCTCTCTGACTACAGG + Intergenic
1129749135 15:78048178-78048200 ACGTGTTCCTCCCTGGTCTCTGG - Intronic
1131047122 15:89323425-89323447 ACGTGGACATCCCTGGCTGCTGG - Exonic
1132137814 15:99360755-99360777 ACGAGGACATCTCTGCCTTCTGG + Intronic
1132605138 16:790509-790531 ACGTGGTCCTCTCCAGTCTCAGG + Exonic
1132888021 16:2190979-2191001 GCGTGGGCCCCTCTGGCCTCAGG - Intronic
1140922436 16:79551510-79551532 ACGTGGCCCTTTCTGTCTCCAGG + Intergenic
1141618128 16:85221713-85221735 AAGTGGGCCTCTCTGGCTCTGGG - Intergenic
1144643810 17:16954858-16954880 ACGTGGTCCTTCCTGGCAACAGG + Intronic
1144822889 17:18087916-18087938 ACGCTGTTCTCTTTGGCTTCCGG + Exonic
1145204977 17:20979527-20979549 ACGTGGTCCTTCCTGGCAACAGG - Intergenic
1147186587 17:38716520-38716542 AGGTGGTCTTCTCTGGCTTTGGG + Exonic
1148667438 17:49385117-49385139 CCTTGGTCCTCTCTTCCTTCTGG - Intronic
1151759182 17:76090940-76090962 GCCTGGTCCTCTCTGGCTGATGG - Intronic
1154195748 18:12265331-12265353 TCGTGTTCCTCTCTGGATGCTGG - Intronic
1157327592 18:46680207-46680229 AGGTGCACCTCTTTGGCTTCTGG - Exonic
1157621473 18:49019417-49019439 TCTTTGTCCTCTCTGGCTGCAGG + Intergenic
1157881755 18:51327543-51327565 ACCTGTTCCTCACTGGCTGCAGG - Intergenic
1158467206 18:57701486-57701508 TAGTGGTTCTCTCTAGCTTCTGG + Intronic
1160006300 18:75071578-75071600 TGGTGCTCCTCTCTGGCTTGTGG - Intergenic
1161872085 19:6878072-6878094 TCCTTGTCCTTTCTGGCTTCTGG - Intergenic
1162039532 19:7961624-7961646 AGGAGGTCCTCTCTGGCACCAGG + Exonic
1162150209 19:8639658-8639680 AGGGTGTCCTCTCTGGCTGCTGG + Intergenic
1162557004 19:11393326-11393348 ACAGGATCCTCTCTGGCATCTGG + Intronic
1163055602 19:14715392-14715414 ACGTGACCCTGCCTGGCTTCAGG + Exonic
1163328873 19:16623232-16623254 GCGTGGTGTTCTCTGACTTCGGG - Intronic
1164892758 19:31839252-31839274 ACCTGCTCCTCTCTGTCTTATGG - Intergenic
927195083 2:20541384-20541406 ACGTGCTGCTCTCTGGGGTCTGG - Intergenic
930942464 2:57028865-57028887 AGGTGCTCATCTCTGGCTTGAGG + Intergenic
931823535 2:65976364-65976386 AAGGGGTCCTCTCTGGCAGCTGG + Intergenic
932226056 2:70041757-70041779 CCATGGTCGTCACTGGCTTCTGG - Intergenic
934580162 2:95431362-95431384 ACCTGGCCCTGTCTGGATTCTGG + Intergenic
934599285 2:95645354-95645376 ACCTGGCCCTGTCTGGATTCTGG - Intergenic
936532633 2:113287353-113287375 ACCTGGCCCTCTCTGACTTCTGG - Intergenic
937098126 2:119248828-119248850 AAGTGGTTCTCTCTGGTTTTTGG + Intronic
937163299 2:119786910-119786932 ACCTGGTCCTACCTGGCTTTAGG + Intronic
938223872 2:129598291-129598313 ACGTGAGCCTCCCTGCCTTCAGG - Intergenic
938754668 2:134368790-134368812 ACCTACTCCTCTCTGGCTCCTGG + Intronic
940003133 2:148987094-148987116 AAGTGCTTCTTTCTGGCTTCTGG - Intronic
945936086 2:215904141-215904163 ACCTGCTCCTCCCTGGCTTGAGG - Intergenic
947909318 2:233790973-233790995 ACATCCTCCTCTCTGCCTTCAGG - Intronic
948943607 2:241208383-241208405 CCTTGGTCCTCCCTGGCTTGTGG + Intronic
1171044074 20:21794085-21794107 ACTTGGTGCTCTCAGGCTGCTGG + Intergenic
1171453845 20:25255441-25255463 ACGTGGTGCCCACTGGCCTCTGG + Intronic
1172229400 20:33326795-33326817 AACTGGTCATCTCTGGCTTGTGG + Intergenic
1173701498 20:45075784-45075806 GTGTGGTCATCACTGGCTTCTGG + Exonic
1176189525 20:63801649-63801671 TCGTGGTCTTGGCTGGCTTCAGG - Intronic
1177953418 21:27567324-27567346 ACATGGTCATCTCTAACTTCAGG - Intergenic
1181539112 22:23563937-23563959 AACTGGTCCTCCCTGGCTTCTGG - Intergenic
1182076404 22:27498344-27498366 TCCTGGTCCTCTCTGACCTCAGG - Intergenic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1183548022 22:38465700-38465722 ACGTGCTTTTCTCTGGCTTGGGG + Intergenic
949626195 3:5869169-5869191 AAGTGCTTCTCTCTGGCTCCTGG - Intergenic
949944939 3:9182443-9182465 TCCTGGTCTTTTCTGGCTTCTGG - Intronic
951812380 3:26715007-26715029 AAGTGATCCTCACTAGCTTCTGG - Intergenic
952746416 3:36785819-36785841 AAGTAATCCTCTCTGGCTTTTGG - Intergenic
952847678 3:37701946-37701968 ACGAGGTCATCTCTGCTTTCAGG + Intronic
954195896 3:48997066-48997088 ACTTGTGCCTCTCTGGATTCTGG + Intronic
956279960 3:67545847-67545869 ATGTGGATCTCTCTGGCTGCTGG - Intronic
961499076 3:127318198-127318220 ACGTGCCCCTCTCAGGCTGCAGG - Intergenic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
965743443 3:171900624-171900646 ACGTGGCCCCATCTGGTTTCAGG - Intronic
968945571 4:3661830-3661852 GCGTGTTCCTCTCGGGCTTGAGG + Intergenic
969313319 4:6366874-6366896 ACGGGTTCCCCTCTGGCTTCTGG - Intronic
969872086 4:10110934-10110956 TCCTGGTCCTCTGTGGCTTAGGG + Intronic
971143553 4:23950982-23951004 ACGTAGTCCTCTCTGCTTTGGGG + Intergenic
980212841 4:129812032-129812054 ACCTGGTACCCTCTGGCTTTGGG - Intergenic
980980590 4:139651467-139651489 GCCTGCTCCTCTCTGTCTTCAGG + Intergenic
981579116 4:146234787-146234809 GGGTGGTCATCTCTGGCTCCTGG + Intergenic
984328669 4:178286956-178286978 ACGTGATCTTCTCTGGCATTCGG - Intergenic
987689880 5:21252851-21252873 ACGTGCTCATCCCTGGGTTCAGG - Intergenic
988449183 5:31322973-31322995 TTGTTGTCCTCTATGGCTTCAGG - Exonic
992906879 5:81355795-81355817 ACTTGCTCCTCTCTGGCCTCTGG - Intronic
994147728 5:96413360-96413382 ACCTGGTTATTTCTGGCTTCAGG + Intronic
997436008 5:133876315-133876337 CCTTGGTCCTCTCTGGCAGCTGG - Intergenic
998394183 5:141807654-141807676 ACTTGATCCCCTGTGGCTTCTGG - Intergenic
1007105852 6:39282404-39282426 AGGGGGTGCTCTCTGGCTGCAGG + Intergenic
1007594203 6:43041499-43041521 AGGTGGTCCTCTCAGCCTTCTGG - Intronic
1011054727 6:83193268-83193290 ACGTGGCCCTGCGTGGCTTCCGG + Intronic
1011797080 6:90968171-90968193 ACCTGGACCTATCTGGCTCCTGG - Intergenic
1013033756 6:106360854-106360876 ACGCGGTCCTCTCTGCCGCCCGG - Intergenic
1013130677 6:107229717-107229739 CTGTAGTCCTCTCTGGCTGCTGG + Intronic
1013765090 6:113565053-113565075 ACGGGGTCCTCCCTGGCTCAAGG - Intergenic
1015880188 6:137864443-137864465 ACGTGGTGCTCTCTTTCATCAGG + Intergenic
1023031821 7:36096436-36096458 AGGTGGTCCCCTCTGACATCCGG + Intergenic
1023824815 7:44001971-44001993 ACGTGCTCCTTCCTGACTTCTGG - Intronic
1025002165 7:55325558-55325580 ACTTGGCCCTCTCTGGCCCCTGG + Intergenic
1026088364 7:67280745-67280767 ACGTGCTCCTTCCTGACTTCTGG - Intergenic
1026426423 7:70298869-70298891 ACGTGGAGCTGTCTGGCTTTTGG - Intronic
1026697618 7:72609635-72609657 ATTTGGACCTCTCTGGTTTCAGG + Intronic
1026725889 7:72869596-72869618 ACGTGCTCCTTCCTGACTTCTGG + Intergenic
1027117966 7:75496050-75496072 ACGTGCTCCTTCCTGACTTCTGG - Intergenic
1027273839 7:76539410-76539432 ACGTGCTCCTTCCTGACTTCTGG + Intergenic
1027327286 7:77058464-77058486 ACGTGCTCCTTCCTGACTTCTGG + Intergenic
1033644982 7:143294258-143294280 AGATGGTCCTGTCTGCCTTCAGG + Exonic
1034309166 7:150071787-150071809 ACGTGGTTTCCTCTGGCTGCGGG + Intergenic
1034436460 7:151064877-151064899 GACTGGTCCTCTCTGCCTTCCGG - Exonic
1034797689 7:154028849-154028871 ACGTGGTTTCCTCTGGCTGCGGG - Intronic
1035628758 8:1092702-1092724 TCAGGTTCCTCTCTGGCTTCAGG - Intergenic
1036078691 8:5528676-5528698 ACGTGGTCTTCCTTGGGTTCAGG + Intergenic
1043441951 8:80283949-80283971 ACCTCCTCCTCTCTGGCTCCCGG - Intergenic
1044532376 8:93321968-93321990 AAGATGTCCTCCCTGGCTTCTGG - Intergenic
1047706217 8:127502324-127502346 ACGTGGCCCGCTCTGGTTTATGG + Intergenic
1048131465 8:131702308-131702330 AGGTAGTTCTTTCTGGCTTCAGG - Intergenic
1049038154 8:140092730-140092752 ACGTGATCATCTCTGGGTGCTGG + Intronic
1049245079 8:141558037-141558059 ACCTGGGCTTCTCTGCCTTCAGG + Intergenic
1049771532 8:144384455-144384477 ACGTGGGTCTCCCTGGCATCTGG + Intronic
1051678274 9:19580544-19580566 AAGTGATCCTCTCTGCCTTGGGG + Intronic
1057693728 9:97309392-97309414 CCTTGGTCCTCCCTGGATTCAGG + Exonic
1059653674 9:116337823-116337845 ATGTGTTCCACTCTAGCTTCAGG + Intronic
1061628965 9:131859472-131859494 AGTGGGTCCTCCCTGGCTTCTGG - Intergenic
1062639229 9:137509005-137509027 ATGTGCTGCTCTCTGTCTTCTGG - Intronic
1189475039 X:41345711-41345733 ACCTGGTGCTCCCTTGCTTCCGG + Intronic
1193311280 X:80013686-80013708 GCGTGGTCCTCCTTGGCCTCTGG + Intergenic
1193478442 X:81996423-81996445 ACTTGGTCCTTCCTGGCTGCTGG + Intergenic
1197268983 X:124405379-124405401 CTGTGGTCCTATCTGCCTTCTGG + Intronic
1202190131 Y:22233566-22233588 ACATGGTCATATCTGACTTCAGG + Intergenic