ID: 1075461155

View in Genome Browser
Species Human (GRCh38)
Location 10:122617367-122617389
Sequence CTGTGGGTTGGGTGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1553
Summary {0: 1, 1: 6, 2: 14, 3: 164, 4: 1368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075461143_1075461155 -4 Left 1075461143 10:122617348-122617370 CCCCTCTCTTTTCATGTCCCTGT 0: 1
1: 1
2: 2
3: 54
4: 650
Right 1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG 0: 1
1: 6
2: 14
3: 164
4: 1368
1075461145_1075461155 -6 Left 1075461145 10:122617350-122617372 CCTCTCTTTTCATGTCCCTGTGG 0: 1
1: 0
2: 1
3: 16
4: 286
Right 1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG 0: 1
1: 6
2: 14
3: 164
4: 1368
1075461144_1075461155 -5 Left 1075461144 10:122617349-122617371 CCCTCTCTTTTCATGTCCCTGTG 0: 1
1: 0
2: 0
3: 45
4: 577
Right 1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG 0: 1
1: 6
2: 14
3: 164
4: 1368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075461155 Original CRISPR CTGTGGGTTGGGTGGGAGGA AGG Intronic
900009894 1:96428-96450 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900026006 1:273012-273034 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900035790 1:406869-406891 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900057412 1:642619-642641 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900195780 1:1374895-1374917 TTGTGGGTTGGGGTGGCGGAGGG - Exonic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900338258 1:2175472-2175494 CTGGGGGTTGGGTTGGTGGTGGG - Intronic
900389860 1:2429123-2429145 CTGGGGATTGGGTGCGAGGAGGG + Intronic
900509468 1:3051711-3051733 GAGTGGGTTGGGTGGATGGATGG - Intergenic
900511503 1:3063092-3063114 CTGCGGTGGGGGTGGGAGGAGGG + Intergenic
900550045 1:3250120-3250142 CTGGGAGTGGGGTGGGGGGAGGG - Intronic
900578160 1:3394375-3394397 CAGAGGGCTGGGTGGGCGGACGG - Intronic
900737692 1:4309391-4309413 TTGTGGGGTGGGTGGGGGCAGGG + Intergenic
901053224 1:6436122-6436144 CTGTGCGGTGGGAGGGAGGGAGG + Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901325897 1:8364902-8364924 CGGTGGGGTGGGGGGGAGGGGGG + Intronic
901375320 1:8834194-8834216 CTCTGGGGAGGGTGGCAGGAAGG + Intergenic
901789367 1:11646398-11646420 CAGGGAGATGGGTGGGAGGAAGG - Intergenic
901928798 1:12583790-12583812 ATGAGGGATGGGTGGGGGGATGG - Intronic
902045096 1:13518206-13518228 CCTTGGGTAGGGTTGGAGGAGGG + Intergenic
902274744 1:15331325-15331347 CTGTGGGTTGGAGGGATGGATGG + Intronic
902360829 1:15941830-15941852 CTGTGGGGTGGGTGGGGAGCTGG - Intergenic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902666661 1:17944073-17944095 GTGTGGGTTGAGGGAGAGGAAGG + Intergenic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
902801136 1:18830995-18831017 GTGTGGGGTGGGTGAGAGGAGGG - Intergenic
902923653 1:19681859-19681881 CTCTGGGGGAGGTGGGAGGAGGG - Intergenic
902953852 1:19910820-19910842 TCGGGGGTGGGGTGGGAGGAGGG + Exonic
902974649 1:20080151-20080173 CAGTGTGGTGGGTGGGAGGGAGG + Intronic
903031094 1:20464939-20464961 CACTGGGTTGGGTTGGGGGAGGG - Intergenic
903139866 1:21332840-21332862 ATGGGGGTGGGGTGGGCGGATGG + Intronic
903269506 1:22178616-22178638 CTGTTGGGTGGGTGGGTGGGTGG - Intergenic
903466880 1:23558183-23558205 TTGGGGGTGGGGTGGGAGCAGGG + Exonic
903486815 1:23695622-23695644 CTGTGTGTTGCGTGGGATGCTGG + Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
904009694 1:27382726-27382748 CGGAGTGTTGGGTGGGAGGGTGG - Intronic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904250653 1:29221756-29221778 CTGTGAGTTGGCTGGGTGGGTGG + Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904591883 1:31619441-31619463 AAGGGGGTTGTGTGGGAGGAGGG + Intronic
904620252 1:31770856-31770878 CTGTGGATGGGGTGGGGGTAGGG + Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
904971752 1:34424615-34424637 GTGGTGGTTGGGTTGGAGGAGGG - Intergenic
905078671 1:35297368-35297390 CTGAGGGTGAGATGGGAGGATGG + Intronic
905255837 1:36683657-36683679 TTGTGGGGTGGGGGGAAGGAGGG - Intergenic
905387797 1:37616225-37616247 CTGTGGCTTGGGTGACAGGTTGG + Intronic
905450482 1:38052903-38052925 GTTTGGGTGGGGTGGGAGGAAGG + Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905863165 1:41363397-41363419 CTGTGAGCTGGGTCAGAGGAAGG + Intronic
905971618 1:42146076-42146098 GTGTGGGTGGGCTGGGAGGGAGG - Intergenic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906156908 1:43619229-43619251 GGGTGGGTGGGGTGGGAGGTGGG + Intronic
906201810 1:43965426-43965448 GGATGGGTAGGGTGGGAGGAGGG + Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906461615 1:46038956-46038978 TTGTAGGTTTGGTGGTAGGAAGG + Intergenic
906561882 1:46764312-46764334 TTGTGGGTTGGCTGGGAGTCAGG + Intronic
906869451 1:49461616-49461638 CTGTTGGTAGGGTGGGGGGCTGG - Intronic
906915121 1:50000903-50000925 CAGGGGGAAGGGTGGGAGGAGGG + Intronic
906993023 1:50759295-50759317 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907512568 1:54972742-54972764 TTCTGGGTTGGGTGGGTGGAGGG + Intergenic
907752133 1:57272821-57272843 CAGTGGGTTGGGTGTGGGGCGGG + Intronic
908095962 1:60738873-60738895 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
908096400 1:60743313-60743335 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
909252984 1:73381789-73381811 CTGTGGGTTGCCAGGGATGAAGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
911785813 1:101945480-101945502 CAGTGGTTTCTGTGGGAGGAGGG + Intronic
911896827 1:103446565-103446587 CTGTTGGTTGGGTCTGGGGAGGG + Intergenic
911950554 1:104168569-104168591 TAATGGGTTGGGTTGGAGGAAGG + Intergenic
912299268 1:108497207-108497229 GTTGGGGGTGGGTGGGAGGAGGG + Intergenic
912380608 1:109246245-109246267 CTGTGGGGTGGGTGGCGTGAAGG - Intergenic
912476794 1:109943209-109943231 CTGTGTGGTGGGTGGTAGGCAGG - Intergenic
912685172 1:111756251-111756273 CGGGGGGTGGGGTGGGAGAAGGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912727973 1:112076016-112076038 CGGAGGGATGGGTGGGTGGATGG + Intergenic
912771126 1:112465086-112465108 ATTTGGGTTGGGTGGGCTGAGGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
913474226 1:119221413-119221435 CTGTAGGGTGTGGGGGAGGAGGG - Intergenic
914330914 1:146670417-146670439 TTGTGTGTTGGGCGGGGGGAGGG + Intergenic
914339201 1:146743803-146743825 ATGTGGGTTGTGTGAGTGGAAGG + Intergenic
914401182 1:147321940-147321962 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
914827293 1:151145475-151145497 TTGGGGGTTGGGTGGGAAGGAGG - Intronic
914955052 1:152154529-152154551 CTCTGGGTTGGATAGAAGGATGG + Exonic
915121033 1:153629630-153629652 CTGTGTGTTGGGGGAGAGAAAGG - Intronic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915701338 1:157799637-157799659 TTGTGGGGTGCGGGGGAGGAGGG + Intronic
915789135 1:158648748-158648770 TGGGGGGGTGGGTGGGAGGATGG - Intronic
915935513 1:160088104-160088126 TTGGGGGTTGGATGGGAAGATGG + Exonic
916058101 1:161081798-161081820 CTGGGGTGGGGGTGGGAGGAGGG - Intronic
916076982 1:161206723-161206745 CTCTTGGTTGGGTGGATGGAGGG + Intronic
916432195 1:164741557-164741579 CTGTTGGTTGGCTGGTGGGAAGG + Intronic
916510375 1:165467790-165467812 CTGGGGGTTGGGCGGAAGGGAGG + Intergenic
916579905 1:166097569-166097591 CTTTGGGTTGCGTGGGAGCTGGG + Intronic
917002603 1:170375948-170375970 GTGTGGGGGGGGTGGGGGGATGG + Intergenic
917232422 1:172852535-172852557 CTGTCGGTGGGGTGGGAGGTTGG - Intergenic
917623490 1:176822043-176822065 ATGTGGGGTGAGTGGGAGGCAGG - Intronic
917911232 1:179648444-179648466 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918168983 1:181977037-181977059 CTGTGGGGTCGGGGGGAGGCAGG + Intergenic
918328607 1:183433942-183433964 GGGTGGGGTGGGTGAGAGGAGGG - Intergenic
919019952 1:192092708-192092730 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
919020444 1:192098456-192098478 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
919451256 1:197775331-197775353 TGGTGGGTGGGGTGGGAGGCGGG - Intronic
919641371 1:200048146-200048168 TTGGGGGTGGGGTGGGGGGAAGG - Intronic
919705345 1:200670024-200670046 CAGTGGCTTGGGAGGGAGGGAGG + Intergenic
919724442 1:200872916-200872938 CTCCGGCTTGGGTGGCAGGAAGG + Intergenic
919728038 1:200896327-200896349 TTCTGGGGAGGGTGGGAGGATGG + Intronic
919775551 1:201191978-201192000 CTGAGGGGTGGGTGGGATGGGGG + Intronic
919803921 1:201369563-201369585 CCCTGGGTTGGGTGGTGGGAGGG - Intronic
919808154 1:201392978-201393000 TTGGATGTTGGGTGGGAGGAGGG + Intronic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
919986076 1:202676179-202676201 CTCTGAATTGGGTGGGGGGAAGG - Intronic
920108992 1:203574001-203574023 CGGAGGGTGGGGTGGTAGGAGGG - Intergenic
920124420 1:203682261-203682283 GTGTGGGTTGTGGGAGAGGAAGG + Intronic
920160855 1:203996719-203996741 CTGTAGGTTGGGAGGGGGTAGGG + Intergenic
920359163 1:205400840-205400862 TTGTGGGGTGGGGGGGGGGAGGG - Intronic
920997850 1:211012311-211012333 CTGTGGGTTTGATTGGAGGGTGG - Intronic
921049982 1:211504366-211504388 CTGGGGGTTTGGTGGGTGGTGGG - Intergenic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
922129462 1:222762570-222762592 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
922258324 1:223912435-223912457 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
922319826 1:224476979-224477001 CTGTGGGCTGCTTGGGAGCAGGG - Intronic
922338098 1:224634020-224634042 CTGTGGTCTGGTGGGGAGGATGG + Intronic
922396088 1:225202497-225202519 CTTTGGGTTGTGTGGGAGCTGGG - Intronic
922618769 1:226978296-226978318 GTGTGTGGTGGGTGGGTGGAGGG - Intronic
923092648 1:230751848-230751870 CTGTGGGGTGGGGGAGGGGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923455885 1:234164829-234164851 CTGTGATTTGGGTGGGGGGGGGG + Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924274500 1:242372007-242372029 GTGTGGGGAGGGTGGTAGGAGGG - Intronic
924339520 1:243015199-243015221 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
924709982 1:246523615-246523637 CTGTGGGTGGGGTGGAGGGGAGG - Intergenic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
1062818430 10:516817-516839 CAGGGGGTAGGGTGGGAGGGGGG + Intronic
1062985151 10:1761531-1761553 CTCTCGGGAGGGTGGGAGGAGGG + Intergenic
1063278552 10:4598611-4598633 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1063450781 10:6148555-6148577 CGGTGGTTAGAGTGGGAGGAAGG + Intronic
1063561323 10:7130677-7130699 CTGTGGGCTGCGTGGGAGTGGGG - Intergenic
1063589100 10:7378594-7378616 CTGTGGGGTGGGTGTGAGTGTGG + Intronic
1063589104 10:7378611-7378633 GTGTGGGTTGAGTGGATGGATGG + Intronic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1063751656 10:8955485-8955507 TTGGGGGTTGGGTGCGGGGAGGG + Intergenic
1063821409 10:9840570-9840592 TTGTGGGTTGGGGGGAGGGAGGG + Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064341649 10:14491003-14491025 CAGTGACTTGGGAGGGAGGAGGG + Intergenic
1064503991 10:16009631-16009653 GGGTGGGGAGGGTGGGAGGACGG + Intergenic
1064605030 10:17030276-17030298 CCGGGGGTGGGGTGGGAGGGTGG - Intronic
1064868019 10:19904422-19904444 CTGTGGGCTGTGTGGGAGTGGGG - Intronic
1065359926 10:24879920-24879942 CTGTGGGGTGAGTGGGGAGAAGG + Intronic
1065439002 10:25729893-25729915 CTGGTGGTGAGGTGGGAGGATGG + Intergenic
1065510990 10:26478332-26478354 CAGTGAGTGGGGCGGGAGGATGG + Intronic
1065898610 10:30185663-30185685 ATTTTGGGTGGGTGGGAGGATGG + Intergenic
1066227127 10:33394187-33394209 TTGTAGGTAGGGTTGGAGGAGGG + Intergenic
1066598692 10:37080137-37080159 GTGTGTGTTGGGTGGGAAGGTGG + Intergenic
1066696620 10:38084702-38084724 ATGAGGGTGGGGTGGGAGGAGGG + Intergenic
1067043384 10:42970311-42970333 GTGGGGGTTGGGTGGGAAGGAGG + Intergenic
1067088051 10:43253171-43253193 GTGTGGGGTGGGTGTCAGGAAGG - Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067231925 10:44418076-44418098 CTGAAGGTTGGGGGGAAGGATGG + Intergenic
1067539644 10:47142262-47142284 CCCTGGGGTGGGTGGGAGCATGG - Intergenic
1067564326 10:47325912-47325934 CTTTGGGTGGGGTGTGGGGAGGG - Exonic
1067730983 10:48811434-48811456 CTATGGGATGGGTGGGTGGCCGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067925686 10:50505902-50505924 TTGTGGTTTGGGTGGGAGTGGGG - Intronic
1068637449 10:59362924-59362946 CTGGGGGTGGGGTGGGAGTGTGG - Intronic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1068948584 10:62755030-62755052 CTTTGGCTTGGATGGAAGGAAGG + Intergenic
1069370769 10:67745506-67745528 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069581349 10:69569064-69569086 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069897846 10:71689854-71689876 CTGGCAGTTGGGTGGCAGGAGGG + Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070678956 10:78435387-78435409 CAGGGAGTTGGGTGGGTGGAGGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070786461 10:79165061-79165083 TTGTGGGTTGGGTAGGGGGGTGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1071374662 10:84990447-84990469 GTGTGTGTTGGGGGGGAGGAGGG + Intergenic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1071578858 10:86752442-86752464 CTGTGGGCTGCGTGGGAGTTGGG + Intergenic
1071971415 10:90911501-90911523 TAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1072029989 10:91509775-91509797 GAGCGGGTAGGGTGGGAGGAGGG + Intronic
1072694497 10:97593127-97593149 CTGAGAGTTGGCTGGGAGGGTGG + Intronic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1072844629 10:98816024-98816046 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1072921794 10:99583027-99583049 AGTTGGGTTTGGTGGGAGGAGGG + Intergenic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1073337074 10:102717573-102717595 ATGTGGCTTGTGTGGGAGGAGGG + Intronic
1073563313 10:104515462-104515484 CTGAGGGTTGGGTGGGAGTGGGG - Intergenic
1073636163 10:105200884-105200906 CACTGGCTTGGGTGGGTGGAGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074112390 10:110431775-110431797 CTGAGGGTTGGTAGGGATGAGGG + Intergenic
1074205137 10:111276631-111276653 CTGGGAGTGGGATGGGAGGAGGG - Intergenic
1074241417 10:111643075-111643097 TCGTGGGGTGGGGGGGAGGAGGG + Intergenic
1074321391 10:112406464-112406486 ATTTGGGTTGGGCCGGAGGAGGG + Intronic
1074378405 10:112957963-112957985 GTTTGGGTTGGATGGAAGGAAGG - Intronic
1074435424 10:113430201-113430223 ATATGGGTTGAGGGGGAGGAGGG + Intergenic
1074586278 10:114770057-114770079 CTGGGGGGTGGGTGGTAGGGAGG - Intergenic
1075092776 10:119452830-119452852 CTTTGGTCTGGGTGGGAGGGAGG + Intronic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075455994 10:122585421-122585443 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458121 10:122598124-122598146 CTGTGGGTTGCATGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075618060 10:123905780-123905802 GTGAGGGTGGGGTGGGAGGCAGG - Intronic
1075645623 10:124094106-124094128 CTTTGGGTTGGGGGGGCGGACGG - Intergenic
1075873840 10:125790163-125790185 CTGTGGGCGGGGTGGGAGCGGGG - Intronic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1076200936 10:128557376-128557398 GCGGGGGTGGGGTGGGAGGAAGG - Intergenic
1076204336 10:128583835-128583857 TTGTTGGTTGGGTGGTTGGACGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076576665 10:131474218-131474240 GTGGGGGTTGGGTTGGGGGAGGG - Intergenic
1076622378 10:131799848-131799870 CTGTGGCTTGATTGTGAGGAGGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076856178 10:133116516-133116538 GTGTGGTCTGGGTGGGAGAAGGG - Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077248533 11:1550692-1550714 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248567 11:1550818-1550840 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248601 11:1550936-1550958 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248636 11:1551062-1551084 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248727 11:1551379-1551401 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248775 11:1551557-1551579 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248792 11:1551614-1551636 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248863 11:1551862-1551884 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077394532 11:2314651-2314673 CAAGGGGTGGGGTGGGAGGATGG - Intronic
1077429224 11:2507769-2507791 CTGTAGCCTGGGTGGGTGGAAGG + Intronic
1077455163 11:2673977-2673999 TTGGGGGTGGGGTGGGGGGAGGG + Intronic
1077472209 11:2769384-2769406 CTGTGAGTTGGGAGGATGGAGGG + Intronic
1077610192 11:3639217-3639239 CTGGGTCTTGGGTGGGAAGAGGG - Intronic
1077696813 11:4400964-4400986 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1077703530 11:4462840-4462862 TTGTGGGTTTGGTGAGAGGGTGG - Intergenic
1077774795 11:5258847-5258869 CTGTGGCTACTGTGGGAGGATGG - Intronic
1077798647 11:5516729-5516751 TGGTGGGTGGGGTAGGAGGAGGG - Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078115869 11:8449629-8449651 TTGTGGGGTGGGTGGGGGGAGGG + Intronic
1078430639 11:11285508-11285530 CTGTGGGATGAGGGAGAGGAGGG + Intronic
1078469416 11:11575202-11575224 CTGTGGGTGGGGTGTGGGGCTGG + Intronic
1078737079 11:14030164-14030186 CTGAGTGCTGCGTGGGAGGAGGG - Intronic
1079095847 11:17509645-17509667 TTGTGGGGTGGGTTGGAGGGTGG + Exonic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1079562440 11:21839134-21839156 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1081192650 11:40122755-40122777 GTGTTTGTTGGGTGGGGGGAGGG - Intronic
1081279285 11:41188146-41188168 TTGTGTGTTGGGTGGGAGGAGGG - Intronic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081428008 11:42946174-42946196 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1081445440 11:43127175-43127197 CAGGGGGTGGGGTGGTAGGAGGG + Intergenic
1082004412 11:47411848-47411870 CAGTGAGTGGGGTGGGATGAAGG + Intronic
1082784018 11:57306908-57306930 GGGGGGGTTGGGTGGGAGGGGGG + Intronic
1082794403 11:57369302-57369324 CCCTGGGTTGGGTGGGATCAGGG - Intronic
1082796029 11:57378376-57378398 TCTTGGGGTGGGTGGGAGGATGG + Intronic
1082864712 11:57888056-57888078 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1082908944 11:58347909-58347931 ATGTGCGGTGGGTGGGAGAATGG - Intergenic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083663980 11:64265008-64265030 CTGGGGGTGGGGTTTGAGGACGG - Exonic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083994099 11:66263752-66263774 GTGAGGGTTGGGTGGGAGGTGGG + Intronic
1083994530 11:66265585-66265607 CTGTGGGCTGGGTGCCAGGATGG + Intronic
1084161781 11:67354008-67354030 GTGGGGGTTGGGTGGGAGCCGGG - Intronic
1084403069 11:68956111-68956133 CTGGGGGTTGGGGGGCAGGGTGG + Intergenic
1084403084 11:68956138-68956160 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084403101 11:68956168-68956190 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084534997 11:69751299-69751321 CTGTGGGCTGGTGAGGAGGATGG + Intergenic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084765214 11:71303879-71303901 ATGTGGGATGGTGGGGAGGAAGG - Intergenic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085093667 11:73741139-73741161 CTGTTGGGGGGGTGGGGGGAAGG - Intronic
1085389538 11:76175508-76175530 CACTGGGCTGGCTGGGAGGAGGG - Intergenic
1085417062 11:76326142-76326164 CCCTGGGGTGGGTGGGTGGAAGG + Intergenic
1086123451 11:83326023-83326045 CAGTGAGTTGGGTGAGTGGATGG + Intergenic
1086244252 11:84732784-84732806 TTGTGGGGTGGGTGGGGGGAGGG - Intronic
1086338545 11:85824319-85824341 CTGTTGGGTGTGTGTGAGGAGGG + Intergenic
1086976941 11:93142943-93142965 TTGGGGGTGGGGTGGGAGGAGGG + Intergenic
1087018623 11:93579550-93579572 CTAGGGGCTGAGTGGGAGGAGGG + Intergenic
1087481504 11:98706927-98706949 GTGGGGGGTGGGTGGGGGGATGG + Intergenic
1087503667 11:98993340-98993362 CAGTGGGTTGGATGGGTGGGTGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087884392 11:103460476-103460498 CAGTGGGTGGGGTGGGGGGTGGG + Intronic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088488806 11:110366948-110366970 GGGTGGGGTGGATGGGAGGAAGG + Intergenic
1088587553 11:111372834-111372856 TTGTGTGTTGGGAGGGAGAAGGG + Intronic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1089040889 11:115448646-115448668 ATGTGTGTTGGGGGGTAGGAGGG + Intronic
1089157843 11:116415609-116415631 GTCAGGGTTGGGTGGGTGGAGGG + Intergenic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090063065 11:123480373-123480395 GTGTGAGATGTGTGGGAGGAGGG - Intergenic
1090114629 11:123955489-123955511 CAGGGGGTTGGGTGGGAGGAAGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090551687 11:127826791-127826813 CTGGGGGTGGAGTGGGAGGGAGG - Intergenic
1090608709 11:128451367-128451389 CGGTGGGTGGGGTGGATGGAAGG + Intergenic
1090753009 11:129763839-129763861 CTTTGGGTTGTGTGGGAGCTGGG + Intergenic
1090796786 11:130142109-130142131 CTGTGGGCTGGGTTGGGGGTGGG + Intronic
1090931547 11:131302011-131302033 TTGTGGGTTGGGTGGGAAAGGGG + Intergenic
1091379748 12:49425-49447 CGATGGATTGGGTGGGAGTAGGG - Intergenic
1091437227 12:482035-482057 CTCGGGGTTGAGTGGGAGGCTGG - Intronic
1091755087 12:3046175-3046197 GGGGGGGTTGGGTGGGAGGCTGG - Intergenic
1091804390 12:3345632-3345654 GTGTGTGTTGGGCGGGGGGAGGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091994455 12:4982294-4982316 TTGGGGTTTGGGTGGGTGGATGG + Intergenic
1092125843 12:6074555-6074577 CTGTGGTGGGGGTGTGAGGAAGG - Intronic
1092128388 12:6091281-6091303 ATGGGGGGTGGGTGGGAGGAGGG + Intronic
1092147260 12:6223221-6223243 CTGGGGTTGGGGTGGAAGGAGGG + Intronic
1092215426 12:6678558-6678580 CTCTGGGTTGGGTCGGCGGGGGG - Intronic
1092218933 12:6700212-6700234 CTGCGGGATGGGTGGGATGGGGG - Exonic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092846443 12:12589518-12589540 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846475 12:12589626-12589648 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846515 12:12589790-12589812 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846575 12:12590026-12590048 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846606 12:12590154-12590176 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846623 12:12590226-12590248 TGGTGGGTTGTGTGGGAGGAAGG + Intergenic
1092846646 12:12590318-12590340 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846671 12:12590425-12590447 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846680 12:12590461-12590483 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846689 12:12590497-12590519 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846699 12:12590533-12590555 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846709 12:12590569-12590591 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846719 12:12590605-12590627 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092846729 12:12590641-12590663 TGGTGGGTTGTGTGGAAGGAAGG + Intergenic
1092903018 12:13077415-13077437 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1093109555 12:15132981-15133003 CTGTGTGTTGGGGGGCAGGGCGG - Intronic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1094079702 12:26520001-26520023 CTGGGAGGTAGGTGGGAGGATGG + Intronic
1094640960 12:32275334-32275356 CAGTGGTTTGGGAGTGAGGATGG + Intronic
1095101241 12:38186157-38186179 TTGTGGGCTGGGGGGGAGGGGGG + Intergenic
1095137463 12:38622927-38622949 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1095387315 12:41666447-41666469 TTGTGGGGTGGGTGGGGGGGAGG - Intergenic
1095703276 12:45212825-45212847 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1095939852 12:47718884-47718906 CTGTTTGTTGGGTGTGTGGAGGG - Intronic
1096807484 12:54149305-54149327 CTGGGGGTTGGCTGGGAAGGGGG + Intergenic
1096854846 12:54473576-54473598 CTGGGGCTTGCGTGGGAGGAAGG - Intronic
1097534863 12:60855924-60855946 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1097751181 12:63354577-63354599 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1097932445 12:65204323-65204345 CAGAGGGTTGGGTGGGGTGAGGG - Intronic
1098061943 12:66572414-66572436 TTGGGGGTGGGGTGGGAGGAAGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098449311 12:70601476-70601498 CTGTTGTTTGGTTGGGAGGCAGG - Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1098733885 12:74071997-74072019 CCGGGGGTGGGGTGGGGGGAGGG + Intergenic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1100090625 12:90965023-90965045 CAGTTGCTGGGGTGGGAGGAGGG - Intronic
1100119806 12:91356312-91356334 CTGTGAGTTGGGGTGGAGCAGGG + Intergenic
1100344686 12:93716536-93716558 CTAGGGGTTGTGTGGAAGGAGGG - Intronic
1100357441 12:93844695-93844717 CTGTTGGTTGGGTGTTGGGAAGG - Intronic
1100571482 12:95847131-95847153 TGCTGGGTTGGGTGGGAGGGGGG + Intergenic
1100918529 12:99455604-99455626 CTGTGGGCTGTGTGGGAGTTGGG + Intronic
1101030816 12:100657563-100657585 GTGTGTGTTGTGGGGGAGGAGGG - Intergenic
1101651878 12:106684675-106684697 CTGTGGGTGGGGGAGGAGCATGG - Intronic
1101684046 12:106999558-106999580 CTGTGGATTAGTTGGGAAGAAGG - Exonic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1101966285 12:109284399-109284421 CTGGGGCTGGGCTGGGAGGAGGG + Intronic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1102164356 12:110794824-110794846 AGGTGGGCTGGGTGGGAGGCAGG + Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102675385 12:114654561-114654583 CTGTGCATTGGGTAGGAAGATGG + Intergenic
1102806129 12:115782511-115782533 ATGTGTGTTGGGTGGCAGGAGGG - Intergenic
1103215239 12:119196681-119196703 CTGTAGGGTGGGAGGGAGAAGGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103612479 12:122132394-122132416 CTGGGGGATGGGTGGGGGAAGGG + Intronic
1103703504 12:122859731-122859753 CCGTGAGCTGGCTGGGAGGAGGG - Intronic
1104251071 12:127094744-127094766 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104554713 12:129789210-129789232 CGGGGGGATGGGTGGGACGAGGG - Intronic
1104610207 12:130221400-130221422 GTGTGTGTTGGGTGGGGGGGGGG - Intergenic
1104675522 12:130709729-130709751 CGCTGGGTTGGGTGGGAAGGGGG - Intronic
1104896277 12:132166546-132166568 ATGAGGGATGGGTGGGTGGATGG - Intergenic
1104924856 12:132308815-132308837 CCGTGGGTGAGGTGTGAGGACGG - Intronic
1104963891 12:132500573-132500595 CTATGGACTGGGTGGGTGGAGGG - Intronic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105969639 13:25416418-25416440 ATGGGGGTGGGGTGGGAGCAGGG - Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106602932 13:31202550-31202572 ATCTGGGTTGGGGGGAAGGATGG + Intronic
1106961514 13:35003930-35003952 GTCAGGGTAGGGTGGGAGGAGGG - Intronic
1107332756 13:39319503-39319525 ATGTGAGCTGGGTGGGAGAAGGG - Intergenic
1107613552 13:42141046-42141068 TTGTGGGGTTGGTGGGAGGGGGG - Intronic
1108359013 13:49652568-49652590 TGGTGGCCTGGGTGGGAGGAAGG - Intergenic
1108462304 13:50678700-50678722 TTGTGGTGTGTGTGGGAGGAAGG + Intronic
1108484533 13:50910371-50910393 CGGTGGCTCGGGTGGGAGGGTGG + Intronic
1108545811 13:51492222-51492244 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108783614 13:53867737-53867759 CTTGGGTTTGGGTGGGAGAAGGG + Intergenic
1108891730 13:55269575-55269597 ATTTGGGGTGGGTGGGTGGAAGG + Intergenic
1109451987 13:62528010-62528032 CTATTGGGTGGGTGGGTGGATGG - Intergenic
1109833618 13:67826371-67826393 CCGTGGGGTGGGGGGGAGGGGGG + Intergenic
1110181772 13:72625979-72626001 CTGTGGGTTCTGTGGGAGCAGGG + Intergenic
1110457231 13:75703146-75703168 GTGTGTGTTGGGGGGGATGAGGG - Intronic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110789746 13:79574673-79574695 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1111746600 13:92278699-92278721 TTTTGTGTTGGGTGTGAGGAAGG + Intronic
1111812429 13:93107734-93107756 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1111950395 13:94704875-94704897 CGGTGGGGGGGGTGGGGGGATGG + Intergenic
1112025390 13:95406659-95406681 CTTGGGGTTGGGGGCGAGGAGGG + Intergenic
1112036391 13:95500491-95500513 GTGAGGGTGGAGTGGGAGGATGG + Intronic
1112060477 13:95734964-95734986 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112075077 13:95904439-95904461 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112099948 13:96177635-96177657 TTGTAGGGAGGGTGGGAGGAGGG + Intronic
1112185551 13:97124740-97124762 GTGTGTGTTGGGGCGGAGGACGG + Intergenic
1112306245 13:98276869-98276891 GCATGGGTGGGGTGGGAGGAAGG + Intronic
1112441419 13:99427097-99427119 CGGAGGGTAGGGTGGGAGGGAGG + Intergenic
1112699450 13:101988703-101988725 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1112928803 13:104710726-104710748 ATGTGGGGCAGGTGGGAGGAGGG + Intergenic
1113231824 13:108219785-108219807 ATGTGGAATGGGTGGCAGGAGGG + Intronic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113475234 13:110575965-110575987 CTCTGGGGTGTGTGGGAGGGAGG - Intergenic
1113730381 13:112637260-112637282 ATGGGAGATGGGTGGGAGGAGGG + Intergenic
1113781503 13:112980132-112980154 GTGTGTTTTGGGTGGGATGAGGG + Intronic
1113792969 13:113040548-113040570 GTGAGGCCTGGGTGGGAGGAAGG - Intronic
1113884572 13:113651928-113651950 CTGATGGGTGGGTGGGGGGAGGG - Intronic
1114454504 14:22846247-22846269 CTGAGGGCTGAGTGGGAGGGCGG + Exonic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1115414873 14:33120508-33120530 CTGTTGGTTGGATGGGTGTAAGG - Intronic
1116373829 14:44171870-44171892 CTGTCGGGGGGGTGGGGGGAGGG - Intergenic
1116489564 14:45490057-45490079 TTGGGGCTGGGGTGGGAGGAGGG + Intergenic
1116502678 14:45639361-45639383 CTGGGGTTGGGGTTGGAGGACGG + Intergenic
1116844600 14:49853482-49853504 ATGGGGGTGGGGTGGGAGGGGGG + Intergenic
1117016617 14:51525003-51525025 TTGTGTGTTGGGTGGGTGGGTGG + Intronic
1117065273 14:52007615-52007637 CTGGGGTTTGGGTGGAGGGAAGG - Exonic
1117112742 14:52475505-52475527 CTTTGGGTTGTGTGGGAGCTGGG + Intronic
1117244185 14:53867344-53867366 CTATTGGTAGGATGGGAGGAGGG - Intergenic
1117275298 14:54187827-54187849 GTGGGGGTGGGGTGGGAGCAGGG - Intergenic
1117951709 14:61089524-61089546 CAGTGGCTTAGGTGGGAGGAGGG + Intergenic
1118034426 14:61851053-61851075 TGGAGGGTGGGGTGGGAGGAGGG - Intergenic
1118073286 14:62269690-62269712 CTGTGGATTGTCTGGGATGAGGG + Intergenic
1118248524 14:64135484-64135506 CTCTGGGGTGGGTGGGAGTGGGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118532232 14:66719012-66719034 CTGTGGATTGCGTGGGAGCTGGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119162111 14:72461254-72461276 CAGTGGAGAGGGTGGGAGGATGG + Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119399204 14:74350229-74350251 CTGTGGGTTGGGAGTGAGTGTGG + Intronic
1119410405 14:74426457-74426479 CTCTGGGGTGCGCGGGAGGAGGG - Intergenic
1119598593 14:75958966-75958988 GTGTGGGTTTGGTTAGAGGAAGG - Exonic
1119733501 14:76966105-76966127 GTGTGTGTTGGGGTGGAGGATGG + Intergenic
1119893303 14:78199309-78199331 CTGTGTGTTGGGTGTGGGGGGGG - Intergenic
1120142371 14:80942830-80942852 CTGCCTGTTGGGAGGGAGGAGGG - Intronic
1120493737 14:85207805-85207827 CTGTGGGATGGTTGGGGTGAGGG + Intergenic
1120854786 14:89203082-89203104 ATGTGGGGGGGGTGGGGGGAGGG + Intronic
1120860074 14:89247070-89247092 CTATTGGGTGGGTGGGTGGATGG - Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121341189 14:93106170-93106192 CTGTGGGGTGGTGGGGTGGATGG - Intronic
1121599739 14:95194455-95194477 CTCTGGGCTGGGGAGGAGGAAGG + Intronic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1122011505 14:98752934-98752956 CTTTTGGATGGGTGGGTGGATGG + Intergenic
1122100553 14:99406045-99406067 TAGTAGTTTGGGTGGGAGGAGGG - Intronic
1122293921 14:100694400-100694422 CTGAGAGTCGGGTGGGGGGAAGG - Intergenic
1122422060 14:101583972-101583994 CTTTGGGTTGGGTAGGAGGGAGG - Intergenic
1122437887 14:101711907-101711929 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437899 14:101711947-101711969 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437946 14:101712082-101712104 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438021 14:101712358-101712380 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438027 14:101712378-101712400 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438043 14:101712438-101712460 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438076 14:101712558-101712580 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438091 14:101712614-101712636 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438106 14:101712670-101712692 CGGTGGGTGGGGTGAGATGATGG - Intergenic
1122438112 14:101712690-101712712 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438124 14:101712730-101712752 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438146 14:101712806-101712828 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438152 14:101712826-101712848 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438170 14:101712886-101712908 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438176 14:101712906-101712928 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122438340 14:101713502-101713524 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438346 14:101713522-101713544 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438352 14:101713542-101713564 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438382 14:101713654-101713676 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122741731 14:103875470-103875492 GTGGGGGTGGGGTGGGTGGATGG + Intergenic
1122813099 14:104298619-104298641 CTGTGGGCTGCATGGGAGCAAGG + Intergenic
1122825749 14:104369660-104369682 CTGGGGGTGGGGTGAGGGGAGGG - Intergenic
1122848064 14:104511459-104511481 CTGGGGTGTGGGTGGGAGGCTGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122913589 14:104845515-104845537 CTGTGGGTGGGGTGGGGGAGGGG - Intergenic
1123075279 14:105664820-105664842 CTGTGGCCTGGGTGGCATGAGGG - Intergenic
1123767398 15:23495161-23495183 GTGGGGGTAGGGTGGGAGGGAGG + Intergenic
1124020866 15:25921694-25921716 TTGGAGGGTGGGTGGGAGGAGGG - Intergenic
1124594469 15:31081647-31081669 CTGTGGCTTTGGTGCGAGGTTGG - Intronic
1124685167 15:31776399-31776421 CTGTGGGGAGAGTGGGAGCAAGG + Intronic
1124718436 15:32090015-32090037 CTGTTGGTGGGGTGGTAGGTGGG + Intronic
1124998885 15:34751729-34751751 ATGGGGGATGGGTGGGAGGGAGG - Exonic
1125019621 15:34971841-34971863 CAGAGGGTTGGGTGGGTGGAGGG - Intergenic
1125580694 15:40783395-40783417 CTCTGGGATGGGTGAGAGGAAGG + Intronic
1125588162 15:40836782-40836804 CTGTGGGGTAGGTTGGAGGGAGG + Intergenic
1125592078 15:40860925-40860947 CTGGGAGTTTGGTGGGTGGAGGG + Intergenic
1125923687 15:43543258-43543280 CTGCTGGTTGGGTGGGGGGAGGG + Intronic
1125997285 15:44174898-44174920 CTGTTGGGGGGTTGGGAGGAAGG + Intronic
1126190229 15:45871307-45871329 CTGTGGGCTACGTGGGAGGTAGG + Intergenic
1126209662 15:46086237-46086259 CGGAGGGTGGGGTGGGGGGAAGG + Intergenic
1126574689 15:50185195-50185217 CTGTTAGCTGGGTGGGAAGAGGG - Intronic
1126663104 15:51051755-51051777 CTTTGGGTTGGGGGAGATGAGGG - Intergenic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1127707590 15:61562453-61562475 TTGAGGGTTGGGTGGGAGGGAGG + Intergenic
1127742481 15:61925171-61925193 GTGGGGGTTGAGTTGGAGGAGGG - Intronic
1127765046 15:62177414-62177436 CTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1128224061 15:65989440-65989462 CTGTGGGTGGGGTGGAAGATTGG - Intronic
1128332780 15:66766707-66766729 CTGTGTGATAGGTGAGAGGAGGG - Intronic
1128570817 15:68731533-68731555 CCCAGGGGTGGGTGGGAGGAGGG + Intergenic
1128658591 15:69481198-69481220 CTGTGGGTTGGGTGCGGGAATGG - Intergenic
1128762639 15:70227925-70227947 CAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1129203356 15:74019526-74019548 CTATGGGATGGGTGGAATGAGGG - Intronic
1129227233 15:74177076-74177098 CTGTGGGATGGTTTGGAGGAAGG - Intergenic
1129337889 15:74864706-74864728 CTGTGGGATTGATGTGAGGAAGG - Intronic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129539065 15:76336601-76336623 GGGTGGGTTGGGTTGGAGGCTGG - Intergenic
1129570834 15:76682260-76682282 CTGTGGGGTGGGGGGGGGAAGGG - Intronic
1129702246 15:77774624-77774646 CTGTGTGGTGGGTGGGCTGATGG - Intronic
1129825653 15:78633485-78633507 CTGTTGGTGGGAAGGGAGGAGGG + Intronic
1129884628 15:79029800-79029822 CAGGCAGTTGGGTGGGAGGAAGG + Intronic
1130133250 15:81160959-81160981 CTTTGGGAAGGGTGGGAGAATGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130264694 15:82389811-82389833 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1130270812 15:82445906-82445928 GTGAGGCTTGCGTGGGAGGAGGG + Intergenic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130463152 15:84173229-84173251 GTGAGGCTTGCGTGGGAGGAGGG + Intronic
1130489522 15:84421559-84421581 GTGAGGCTTGCGTGGGAGGAGGG - Intergenic
1130501113 15:84500321-84500343 GTGAGGCTTGCGTGGGAGGAGGG - Intergenic
1130508629 15:84570411-84570433 GGGAGGCTTGGGTGGGAGGAGGG - Intergenic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1131091771 15:89629198-89629220 CTGTGGGCTGGGTGGGGGCCGGG + Intronic
1131317578 15:91353557-91353579 CTGTATGTTGGGTGAGAGAAAGG - Intergenic
1131693116 15:94847309-94847331 CTTTGGGGTGGGTGGTGGGAAGG - Intergenic
1131829280 15:96344014-96344036 CTCTGGGTTGGGGGTGAGGTGGG + Intergenic
1131957743 15:97755608-97755630 GTGTGTGTTGGGTGGGTGGGTGG - Intergenic
1132013964 15:98299931-98299953 CTGTGGGATGGGCTGGAGGTGGG - Intergenic
1132083104 15:98884215-98884237 CTGTGGGTTGGGTGTGGGGGAGG - Intronic
1132260773 15:100422932-100422954 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1132306784 15:100820795-100820817 CCCTGGGTTAGGTGGGGGGATGG - Intergenic
1132484825 16:185391-185413 GTGTGGGTTATTTGGGAGGAGGG + Intergenic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132573944 16:656279-656301 CTGTGGGTGGGGTGGGGTCAGGG - Intronic
1132626616 16:894440-894462 CAGGGGGATGGGTGGGCGGACGG - Intronic
1132653875 16:1033604-1033626 CTGTTGGATGGATGGGTGGATGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133400173 16:5479954-5479976 CTGTGGGCTGGGCTGGAGGGTGG - Intergenic
1133818108 16:9213566-9213588 CTGTGGGTTGAGTGGGTTCAGGG + Intergenic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1133894450 16:9912504-9912526 AAGTGGGTGGGGTGGGGGGAGGG + Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134514465 16:14875562-14875584 CTGTTGGTTGGATGGATGGATGG + Intronic
1134702141 16:16274215-16274237 CTGTTGGTTGGATGGATGGATGG + Intronic
1134925280 16:18153726-18153748 CTGTTGGTGGGGTGGGGGGCTGG + Intergenic
1134969689 16:18520435-18520457 CTGTTGGTTGGATGGATGGATGG - Intronic
1135235901 16:20755777-20755799 CTGTGGGGTGGGGGGGGGGGAGG - Intronic
1135382304 16:22005246-22005268 CTTAGGGGTGGGTGAGAGGATGG + Intergenic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135563541 16:23494606-23494628 CTGGGGGTTGGCTGAGGGGAGGG - Intronic
1135883258 16:26279750-26279772 CTGTGTGTTGCATGGGAGCATGG - Intergenic
1136189446 16:28606930-28606952 AGGTGGGTTTGATGGGAGGAAGG - Exonic
1136238068 16:28926664-28926686 CTGTGGGGTGGGTGTTGGGAGGG + Intronic
1136552847 16:30990743-30990765 TTGTGGGTTTGGTGGCAGGTAGG - Exonic
1136940457 16:34520202-34520224 TGGTGGGGTGGGTGGGGGGAGGG + Intergenic
1136959362 16:34828368-34828390 TGGTGGGGTGGGTGGGGGGAGGG - Intergenic
1137055252 16:35742814-35742836 CTTTGGGTTGGGAGGAAGGGTGG + Intergenic
1137427147 16:48389339-48389361 CTGTGGGTTGGGCATGAGGCAGG - Intronic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137574552 16:49590350-49590372 CTGTGGCTTGGGTGTGAGCCGGG - Intronic
1138170166 16:54841671-54841693 CTGTGTGTTGGGAGGAAGGGAGG + Intergenic
1138434283 16:56988684-56988706 CTGTGGGATGTCTGGGAGGTGGG + Intergenic
1138489983 16:57371219-57371241 CATTGGGTTGGGTGGGGGGGCGG + Intergenic
1138544279 16:57706598-57706620 TGGGGGGGTGGGTGGGAGGATGG - Intronic
1138605148 16:58083857-58083879 GTGTGGGTTGGGTGGGGGTGTGG - Intergenic
1138703691 16:58892576-58892598 CTGAGGGTTGTGTGGGAGATGGG - Intergenic
1138736758 16:59259873-59259895 TTGTGGGTGGGGTGGGATGGGGG + Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139917431 16:70437432-70437454 CAGTGGGTTGGGTGGAGGAAAGG - Intronic
1139995077 16:70973549-70973571 ATGTGGGTTGTGTGAGTGGAAGG - Intronic
1140193209 16:72835690-72835712 CTCTGTGGTGGGTGGAAGGAAGG + Intronic
1140256885 16:73345384-73345406 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1140430465 16:74898553-74898575 GTGGGGGTTGGGGGGCAGGAGGG + Intronic
1140864923 16:79051562-79051584 CTGTGTGCTGGGTGGGTGGGAGG + Intronic
1140866597 16:79067618-79067640 GTGTGGGTGGGGTGGGGGGCGGG + Intronic
1141132130 16:81444344-81444366 CCGGGGGCTGGGTGGAAGGACGG - Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141517850 16:84558393-84558415 CTGGGAGGAGGGTGGGAGGAGGG - Intergenic
1141540168 16:84713946-84713968 CTGGGGGTTGGCTGGGAAGGTGG + Intronic
1141606559 16:85157285-85157307 ATGATGGTTGGGTGGGTGGATGG - Intergenic
1141619765 16:85230880-85230902 CAGAGGGATGGGTGGAAGGATGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141695113 16:85615406-85615428 CTGCGGGCCGGGTGCGAGGATGG + Intronic
1141699122 16:85634417-85634439 CTGTGACTTGATTGGGAGGAGGG + Intronic
1141881812 16:86865312-86865334 CAGGGGGTTGGGTGGGAAGGCGG - Intergenic
1142196831 16:88742859-88742881 CCGTGGCTGGGGTGGGAGCAGGG + Intronic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1142270355 16:89085785-89085807 CTAAAGGTGGGGTGGGAGGAGGG - Intergenic
1142355091 16:89598224-89598246 CGGGGGGATGGGTGGGCGGATGG - Intergenic
1142454436 16:90210476-90210498 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142587257 17:981034-981056 CAGTGGGTTGGGTTGGGGGGAGG - Intergenic
1142597508 17:1036656-1036678 GTGCGAGTTGGGCGGGAGGATGG + Intronic
1142931974 17:3292821-3292843 CTGGGGGGCGGGTTGGAGGAGGG - Intergenic
1143188507 17:5024425-5024447 CTATGGGTGGGGTGGGGGGCTGG + Exonic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143481117 17:7227880-7227902 ATGGGGAATGGGTGGGAGGAGGG - Intronic
1143724658 17:8836917-8836939 CTGTGGCCTGGGTGAGAGGGAGG + Exonic
1143739609 17:8942530-8942552 AGGTGTCTTGGGTGGGAGGAAGG + Intronic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144432466 17:15206769-15206791 CAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1144754275 17:17669810-17669832 CTGTGGGATGGGGGTGGGGAGGG - Intergenic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145799485 17:27673838-27673860 CTGTGGGTGGGGTGGAGGGGAGG - Intergenic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1146159533 17:30552477-30552499 CTGTGGGTGGGGTGGAGGGGAGG + Intergenic
1146274886 17:31510262-31510284 CTGTTGGTTGGCTGGGAGTGGGG + Intronic
1146598004 17:34186106-34186128 CTTTGGGTTGGGGAGAAGGACGG - Intergenic
1146665391 17:34699167-34699189 ATGTGGATAGAGTGGGAGGAAGG + Intergenic
1146761038 17:35479063-35479085 CTTTGGCTTGGGTGGCAGGAAGG - Intronic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146928810 17:36763656-36763678 CTGTGGACTGGGTGGAAGAAGGG + Intergenic
1147146087 17:38485292-38485314 CTGTGGGTGGAGTGGGAGTTTGG + Intronic
1147228947 17:39003186-39003208 CTGTGGCTCGAGGGGGAGGAGGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147454940 17:40531288-40531310 GGGTGGGGTGGGTGGCAGGATGG - Intergenic
1147534081 17:41307189-41307211 CAGAGGGATGGGTGGGTGGATGG + Intergenic
1147647364 17:42041771-42041793 CTATGGGCTGGGTTGGAGGTGGG - Intronic
1148196419 17:45716460-45716482 TGGGGGGTGGGGTGGGAGGAGGG + Intergenic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148699749 17:49580254-49580276 CTGTGGGTGGGGGGAGGGGAGGG + Exonic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148905709 17:50910531-50910553 CTGTGGTCTGGGTGGGGGCAGGG + Intergenic
1148985878 17:51620629-51620651 GGGAGGGTGGGGTGGGAGGATGG + Intergenic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1149402518 17:56312769-56312791 CTGTGAGTTGCATGGGAGCAGGG - Intronic
1149449808 17:56740785-56740807 GAGAGGGTTGGGTGGGGGGAAGG - Intergenic
1149505610 17:57191303-57191325 CTGTGGATTGGGTGAGAGGCAGG + Intergenic
1149775447 17:59353452-59353474 CTGTAGGTCCGGTGGCAGGAGGG - Exonic
1149996783 17:61409843-61409865 GGGTGGGTGGGCTGGGAGGATGG + Intergenic
1150081323 17:62242151-62242173 TTGTGGGCTGGCTGGCAGGAGGG - Intergenic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150455831 17:65305638-65305660 CCATGGGCTGGGTGGGGGGAGGG + Intergenic
1150528632 17:65953643-65953665 CTGAGGGCTGTGTGGGAGCAGGG + Intronic
1150887868 17:69108679-69108701 TTCTAGTTTGGGTGGGAGGATGG + Intronic
1151379752 17:73717570-73717592 CTGTGGGATCGGTGGGGGGAGGG - Intergenic
1151502361 17:74499244-74499266 CTAGGGGTAGGGTAGGAGGAAGG - Intergenic
1151569179 17:74917578-74917600 CTCTGGGGTGGACGGGAGGAGGG + Exonic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152118060 17:78400886-78400908 CTGTGGGTGGGGTGGAGTGAGGG + Intronic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152141582 17:78540338-78540360 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152141702 17:78540770-78540792 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152252126 17:79217762-79217784 ATGGGGGTGGGGTGGGAGGCAGG + Intronic
1152525809 17:80887653-80887675 CTCTGGGGTGGGAGAGAGGAGGG + Intronic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152596933 17:81242375-81242397 CTGTGGGTGGGATGGGAGGCTGG - Intergenic
1152684856 17:81688928-81688950 CCCTGTGTTGGGAGGGAGGAGGG + Intronic
1152767498 17:82149046-82149068 CGGATGGTTGGGTGGGTGGATGG + Intronic
1152803788 17:82344934-82344956 CCGTGGGCTGGGTGGGAGTGCGG + Intergenic
1152862408 17:82703819-82703841 GTGGGGGTTGGGTGAGAGGTGGG - Intergenic
1153051368 18:905767-905789 CTGTGGGCCGGGTTGGGGGAGGG - Intronic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153301297 18:3594353-3594375 CTTTTGGTTGGGAGGGAGGGAGG - Intronic
1153408459 18:4766763-4766785 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1153995139 18:10434150-10434172 CTGTGGGTTGGGGGGGGTGGTGG - Intergenic
1154377646 18:13823052-13823074 CAGTGGGTTGGGTGGATGGGTGG - Intergenic
1155312011 18:24533125-24533147 CTGGGGTTGGGGTGGGAGTAGGG + Intergenic
1155336504 18:24770433-24770455 ATGTGGGTAGGGTAGGAGGCAGG - Intergenic
1155426545 18:25713264-25713286 TTTGGGGTTGGGTGGGGGGAGGG + Intergenic
1155518088 18:26642873-26642895 CTGCGGGGAGGGTGGGAGGGCGG + Intronic
1155608924 18:27640784-27640806 CTGTGAATGGGATGGGAGGAGGG + Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157418881 18:47528224-47528246 CTGTGGGTGGGTTAGCAGGATGG + Intergenic
1157559594 18:48637176-48637198 CTGTTGGTTGGCTGGGGGGATGG - Intronic
1157639585 18:49200182-49200204 CTTAGGGGTGGTTGGGAGGAGGG + Intronic
1157650881 18:49329281-49329303 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158180228 18:54707225-54707247 TTGTGGGGTGGGTGAGGGGAGGG - Intergenic
1158185116 18:54762717-54762739 CGGTGTGTTGGGGAGGAGGAAGG - Intronic
1158447571 18:57534448-57534470 GTGTAGACTGGGTGGGAGGAGGG - Intergenic
1158565657 18:58552210-58552232 CTGGGGTTGGGGTGGGAGGTAGG - Intronic
1158573307 18:58614904-58614926 GTGTGTGTTGGGGGGGAGGGTGG - Intronic
1158602250 18:58864576-58864598 CTGTGGGGTGGAGGGGAGGGGGG + Intronic
1158616001 18:58987638-58987660 CTGTGGGTTGGCTGGAGGCATGG + Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1160357919 18:78244394-78244416 TTGGGGGTTTGGTTGGAGGAGGG - Intergenic
1160543114 18:79636139-79636161 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1160632873 18:80258670-80258692 GTGTGGGGTGGGTGGGTGGGGGG + Intergenic
1160752000 19:738766-738788 GTCGAGGTTGGGTGGGAGGAGGG + Intronic
1160970403 19:1765364-1765386 CTGCTGGCTGGGAGGGAGGATGG - Intronic
1161055378 19:2188332-2188354 CTGGGGCTGGGGTGGGAGCAGGG + Intronic
1161131281 19:2590521-2590543 TGGTTGGTTGGGTGGGTGGATGG - Intronic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161289957 19:3488354-3488376 CTGTTGGTGGGGTGTGCGGAAGG + Intergenic
1161422799 19:4184969-4184991 CTGGTGGGTGGGTGGGTGGATGG + Intronic
1161422808 19:4184997-4185019 TTGGTGGTTGGGTGGGTGGATGG + Intronic
1161641076 19:5423751-5423773 GTGTGGGTGGAGTGGGTGGAGGG - Intergenic
1161687156 19:5708453-5708475 GGGTGGGCTGGGTGGGAGCATGG + Intronic
1161760525 19:6167950-6167972 GTGGGAGTTGGGTGGGAGGCGGG - Intronic
1161974060 19:7599282-7599304 GAGTGGGGTGGGTGGGTGGATGG - Intronic
1161974465 19:7600539-7600561 ATGGGGGGTGGGTGGGTGGATGG - Intronic
1161981694 19:7633375-7633397 CTGGGGGTGGGGTGGGGGCAGGG + Intronic
1162107528 19:8379072-8379094 CTCTGGGTTTGATGGGAGGGAGG + Intronic
1162200743 19:9018327-9018349 CTGTTGGCTGGGCGGGCGGAGGG - Intergenic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162345921 19:10117945-10117967 AGGAGGGTGGGGTGGGAGGATGG + Intronic
1162588501 19:11576211-11576233 CTGTGGGTGGGGTGGGAGCTGGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163084436 19:14969193-14969215 CCGTGAGGTGGGTTGGAGGAAGG - Intronic
1163409621 19:17145901-17145923 CTGAAGGGTGGGTGGGTGGATGG + Intronic
1163587760 19:18173280-18173302 GTGGGGGTTGGGTGTGAGGGAGG + Intronic
1163719404 19:18891576-18891598 CTGGGGGTTGGGGGTGTGGAGGG - Intronic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165070802 19:33253850-33253872 CTGTGGGGTGGGTAGGGGGCTGG + Intergenic
1165103920 19:33457438-33457460 CTGTGGGCTGGCAGGGATGAGGG + Intronic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165879291 19:39031563-39031585 CTGTGGGAGGGGTGGGAGTGGGG - Intronic
1165915029 19:39253238-39253260 GTGAGGCTGGGGTGGGAGGATGG - Intergenic
1165935201 19:39384735-39384757 AGGTGGGTTGAGGGGGAGGAGGG - Exonic
1166411994 19:42561655-42561677 CTTGGGAGTGGGTGGGAGGAGGG - Intergenic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167133698 19:47604134-47604156 TTGTGAGTTGTGTGGGAGGCAGG + Intergenic
1167162840 19:47778940-47778962 ATGTGGGTGGGGTGGGCGTACGG + Intronic
1167562266 19:50232924-50232946 CTGTGGGAGGGCTGGGAGCAGGG + Intronic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167612792 19:50515345-50515367 CTGTTGGGTGGGTTGGGGGAGGG - Intergenic
1167616289 19:50535984-50536006 CTGCGGGTGGGGTGGGAGAGTGG + Intronic
1168159276 19:54498264-54498286 CTGAGGGTGGGGTGGTAGCAGGG - Intronic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168252265 19:55147593-55147615 CTGGGGGGTGTGTGGGAGGGTGG + Intronic
1168498911 19:56876987-56877009 CTGTGTCATGGGTGGGAGGGAGG - Intergenic
1202715065 1_KI270714v1_random:37869-37891 CTGTGCGGTGGGAGGGAGGGAGG - Intergenic
924981124 2:222542-222564 CTATGGGATGGGTAAGAGGACGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925366851 2:3316554-3316576 CTGTGAGTTGGGAGAGAGGCAGG - Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925878916 2:8334174-8334196 CAGCGGGTTGGGTGCGGGGAGGG + Intergenic
926087325 2:10028638-10028660 ATGTGTGTTGGAGGGGAGGAGGG - Intergenic
926706851 2:15843262-15843284 CTGTGGGTTGGGTAAGCAGAGGG + Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
926963156 2:18380780-18380802 ATGTAGGGTGGGTGGGAGGTGGG + Intergenic
927036741 2:19185274-19185296 CTGTGGGCTGTGTGGGAGCGGGG - Intergenic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927326311 2:21809764-21809786 CTTTGGGGTGGGTGATAGGAAGG - Intergenic
927424937 2:22971098-22971120 CTGTGGGGGGGGTGGGGGGGGGG + Intergenic
927499765 2:23574943-23574965 CTGAGGAATGGGTGGGAGGGTGG + Intronic
927554262 2:24021494-24021516 CTGTGGGGTGATTGGGAGGTGGG + Intronic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
927944891 2:27129688-27129710 ATGTGGGTTGGGACAGAGGAAGG - Intronic
928164991 2:28964631-28964653 TGGGGGGTTGGGTGGGGGGAGGG - Intronic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
928410696 2:31051916-31051938 ATGAGAGTTGGGTGGGCGGAGGG - Intronic
928787351 2:34904878-34904900 GTGTGTGTTGGGCGGGAGGGTGG + Intergenic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929317162 2:40493342-40493364 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
929687236 2:44045305-44045327 CCCTGGGTAGGATGGGAGGAGGG - Intergenic
929745262 2:44650429-44650451 TTGTGGGTTAGGTGGAGGGAAGG + Intronic
929794359 2:45047540-45047562 CTTGTGGTTTGGTGGGAGGAAGG + Intergenic
929877470 2:45808631-45808653 CACTGGGTTGGGTGGTGGGAGGG + Intronic
930024330 2:47021156-47021178 TCCTGGGTTGGATGGGAGGAAGG + Intronic
930027557 2:47038638-47038660 CGGGGGGGTGGGTGGGGGGAGGG - Intronic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930105747 2:47638016-47638038 CTGGCTGTTGGATGGGAGGATGG - Intergenic
931147514 2:59535247-59535269 CTGTGGGTGGGGTTGGAGGCTGG + Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931241972 2:60461792-60461814 CCGGGGGCTGGGAGGGAGGAGGG + Exonic
931527647 2:63174712-63174734 CTGTGGGTTGGGCAAGAGGGAGG + Exonic
931846788 2:66212213-66212235 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
932369317 2:71174470-71174492 CTGGGAGTGGGGTGGGTGGATGG - Intergenic
932476443 2:72009307-72009329 TAGTGGCTGGGGTGGGAGGAGGG - Intergenic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
933336806 2:80968488-80968510 CACTTGGTTGGGTGGGAGGCAGG - Intergenic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
934572065 2:95379124-95379146 CTGGGGGATGGGTGGGGGGCTGG - Intronic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
935154770 2:100474328-100474350 CTGTGGGTTGGGGGAGGTGAGGG - Intronic
935362504 2:102259034-102259056 ATGTGTGTTTGGTGAGAGGAAGG - Intergenic
935591644 2:104850988-104851010 GTGAAGGTGGGGTGGGAGGAGGG - Intergenic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
935953881 2:108355349-108355371 CTGTGGTTTGTGTGTGAGGATGG - Intergenic
935954586 2:108363044-108363066 CTGTGGGTGGGGTTTGGGGATGG + Intergenic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936150957 2:110022269-110022291 CACTGGGTTGGGTGTGTGGATGG - Intergenic
936497124 2:113032087-113032109 CTCTGGGTTGAGAGGAAGGAGGG + Intronic
936564116 2:113569416-113569438 CGATGGATTGGGTGGGAGTAGGG + Intergenic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937828960 2:126399498-126399520 CTTTGGGTTGTGTGGGAGCTGGG - Intergenic
937916967 2:127103998-127104020 CTGTGGCCTTGGTGTGAGGAGGG - Intronic
938087105 2:128408833-128408855 CTGTGGTTAGGGTGGGCGGCGGG + Intergenic
938090242 2:128426505-128426527 GTGTGGGGAGGATGGGAGGAGGG - Intergenic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
938218189 2:129541044-129541066 TTGTAGGGTGGGGGGGAGGAGGG + Intergenic
938395898 2:130947746-130947768 TGCTGGGTTGGGTGTGAGGAAGG - Intronic
938574881 2:132594584-132594606 GTTTGGTTTGGGTGGGAGGCAGG - Intronic
938665181 2:133527481-133527503 TTGGGGGGTGGGTGGGTGGAGGG - Intronic
938684956 2:133729179-133729201 CTGAGGTTTGGGTTGGATGAAGG + Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939261809 2:139820429-139820451 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
940785003 2:157971800-157971822 CTTTGGGTTGGGTGGGAGCTGGG - Intronic
941211966 2:162651357-162651379 TTGGGGGTGGGGTGGGAGGAGGG - Intronic
941583699 2:167331360-167331382 CAGTGGGCTGGGTGGGCGGATGG + Intergenic
941885505 2:170523449-170523471 CAGAGGGTGGGGTGGGAGTAGGG + Intronic
942042642 2:172081162-172081184 GTGTGGGGTGGGTGGGGGGAGGG - Exonic
942460817 2:176167254-176167276 TTGTGGTTTGGGTGGGAGGTAGG + Intronic
942543038 2:177034670-177034692 TTGTGGGATGGGGGGGGGGAGGG - Intergenic
943013903 2:182487646-182487668 CTGTGGTTGGGGTGTGGGGATGG + Intronic
943331863 2:186569484-186569506 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
943756377 2:191561233-191561255 CGGAGGGTGAGGTGGGAGGATGG + Intergenic
944026941 2:195181880-195181902 GTGGGGGTGGGGTGGGGGGAGGG - Intergenic
945051138 2:205825331-205825353 CTGTGGGTTGACTGGGGGTAAGG + Intergenic
945691413 2:213041336-213041358 TTTTGGGGGGGGTGGGAGGATGG + Intronic
945760548 2:213908918-213908940 TTGTGTGGTGGGGGGGAGGAGGG - Intronic
946070925 2:217033657-217033679 CTAAGGGATGGGTGGGAGCAGGG + Intergenic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946275396 2:218627935-218627957 CTCTGGATGGAGTGGGAGGAAGG + Intronic
946325035 2:218980750-218980772 GTGAGGGTTGGGTGGAAGGGTGG + Intergenic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
946748047 2:222864814-222864836 CTGTGTCTTTGCTGGGAGGAGGG + Intronic
947136943 2:226984917-226984939 CTGGGGGTTGGGGTGGGGGAGGG + Intronic
947232697 2:227903694-227903716 CTTGGGCTGGGGTGGGAGGAAGG - Intronic
947461075 2:230305765-230305787 CTGTGGGCAGGGTGGGTGCAGGG - Intronic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
947836962 2:233182789-233182811 CTCCGGGTGGGATGGGAGGAGGG + Intronic
947910358 2:233796501-233796523 CAGAGGGTTGGGTGTGGGGAGGG - Intronic
948070136 2:235114208-235114230 CTCTGCCTAGGGTGGGAGGAAGG - Intergenic
948155147 2:235775610-235775632 CTCGGGGCGGGGTGGGAGGAAGG - Intronic
948229214 2:236337352-236337374 GTGTGGGCTGGGCAGGAGGAGGG - Intronic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
948768102 2:240233662-240233684 CTGTGGGCGGGGTCAGAGGAGGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
949085894 2:242155131-242155153 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168853656 20:993608-993630 ATGTGGGTAGCCTGGGAGGAGGG + Intronic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170174679 20:13455512-13455534 GTGAAGGTTGGGTGGGAGAATGG + Intronic
1170176088 20:13471645-13471667 ATGTGGGATGGATTGGAGGAAGG - Intronic
1170476976 20:16725118-16725140 GTGTGTGTTGGGCAGGAGGAGGG + Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1170888987 20:20363789-20363811 GTGTGAGTGGGGTGGGAGGAAGG + Intergenic
1171062037 20:21974366-21974388 CAGTGGGAAGGATGGGAGGAGGG - Intergenic
1171143943 20:22765685-22765707 ATGTGCCTGGGGTGGGAGGAGGG + Intergenic
1171149402 20:22813961-22813983 CTATTGGTTGGTGGGGAGGAAGG - Intergenic
1171395308 20:24829264-24829286 CTGTGGGGTGGCTGGGAGGAGGG + Intergenic
1171405237 20:24908336-24908358 CTGTTGGAGGGGTGGGAGGTGGG + Intergenic
1171780461 20:29411823-29411845 TTGTGGGGTGGGTGGGTGTAGGG + Intergenic
1172216077 20:33236745-33236767 TTGTGTGTTGGGTGAGGGGAGGG + Intronic
1172771279 20:37384069-37384091 CTGTGGAATGGGTGGGAGGGAGG + Intronic
1172772402 20:37389298-37389320 CTGGAATTTGGGTGGGAGGAAGG - Intronic
1172811233 20:37649731-37649753 CTGAGGGTTGGGTCGGGGGAAGG + Intergenic
1172910508 20:38405890-38405912 GTGTGGCTGAGGTGGGAGGATGG + Intergenic
1173177767 20:40777448-40777470 GTGGGGGTGGGGTGGGAGGGTGG - Intergenic
1173324265 20:42018403-42018425 CTGTGGGCTGGGTTGATGGATGG + Intergenic
1173558965 20:43988629-43988651 CTGTGGGTTTCGTGGGGGCAGGG + Intronic
1173591922 20:44231485-44231507 CTGTGGGTTGGGTGTGAGCTTGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174556398 20:51398432-51398454 CTCAGGGTTGGGCGGGAGAAGGG - Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175134085 20:56809979-56810001 CTGTTGGTTAGGTGGGAGAAGGG - Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175292512 20:57886004-57886026 CGGGGGGAAGGGTGGGAGGAGGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175643505 20:60651330-60651352 CTGTGCCTTGGGTTGGAGGAGGG - Intergenic
1175962067 20:62642354-62642376 CTGTGCCCTGGGGGGGAGGAGGG + Exonic
1176138007 20:63533479-63533501 CTGTTGGCGGGGTGGGAGGGTGG + Intronic
1176206201 20:63889544-63889566 CCGGGGGTAGGGCGGGAGGAAGG - Intronic
1176314130 21:5225878-5225900 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1176359417 21:5982601-5982623 TGGTGGGTTGGGTGGGTGGGTGG + Intergenic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1177176444 21:17704939-17704961 CTTTGGGTTGTGTGGGAGCTGGG + Intergenic
1177649250 21:23939447-23939469 GAGTTGGTGGGGTGGGAGGAAGG - Intergenic
1177708235 21:24736979-24737001 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1178732841 21:35120594-35120616 CTGCGGGCTGTGTGGGAGTAGGG + Intronic
1178788161 21:35673606-35673628 CTGTGGGGTGGGTCAGAGGAGGG + Intronic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179354116 21:40642685-40642707 GGGTGGCTAGGGTGGGAGGATGG - Intronic
1179467871 21:41589737-41589759 CTGTGGGCTGCATGGGAGCAGGG - Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179644428 21:42766954-42766976 CTGGGGGTGGGGTGGGAGTGGGG - Intronic
1179764101 21:43555949-43555971 TGGTGGGTTGGGTGGGTGGGTGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180391942 22:12291997-12292019 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1180407802 22:12572759-12572781 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
1180671556 22:17557665-17557687 GGGTGGGTGGGGTGGGAGCAGGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181033288 22:20158270-20158292 CTGGGGCTTGGGTGGGAGTGGGG + Intergenic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181441462 22:22938040-22938062 ATGTGGGTTGGGAGGCAGGCAGG - Intergenic
1181537094 22:23552033-23552055 CGGTAGGGTGGATGGGAGGATGG - Intergenic
1181599520 22:23941252-23941274 GTGTGGAGTGGGTTGGAGGAGGG + Intergenic
1181797388 22:25320090-25320112 CTGTGGGTGGGGTGGGGGCTGGG - Intergenic
1181806175 22:25375739-25375761 TGGTGGGTGGGGTGGGAGGTGGG - Intronic
1181852705 22:25761453-25761475 CTGGAGTTTGGGTGGGAGGAGGG + Intronic
1182045884 22:27273911-27273933 CGGTGGGGTGGGGGGGAGGGGGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182279149 22:29208206-29208228 CTGGGGTGTGGGTGGCAGGAAGG - Intronic
1182923271 22:34099440-34099462 GTGTGGGTGGGGTGGGGGAAAGG + Intergenic
1182959639 22:34460150-34460172 AGTTGGGTTGGGTGGGGGGAAGG - Intergenic
1183109365 22:35637714-35637736 CTTAGGGTGGGGTGGGAGGATGG - Intronic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183416807 22:37687260-37687282 CTGTGGGGCGGGTGGGGGGGGGG - Intronic
1183521036 22:38296161-38296183 CTATGGGTTGGATGGGACCATGG - Intronic
1183903440 22:41022526-41022548 CCTTGGGTTGGGTGGCAGGGTGG - Intergenic
1184257823 22:43297072-43297094 CTGGTGGCTGGGTGGGACGAGGG - Intronic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1184744680 22:46449408-46449430 CTGTGTGATGGGTGGTTGGATGG - Intronic
1184840665 22:47050751-47050773 CCTTGGGGTGGGTGGGATGAGGG + Intronic
1185015931 22:48342602-48342624 CTGTATCTTGGGTGGCAGGATGG - Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185379633 22:50502527-50502549 CCCTGGGTTGGGACGGAGGAGGG - Intergenic
949465019 3:4335188-4335210 GTGAGGAATGGGTGGGAGGATGG - Intronic
949876001 3:8626501-8626523 ATGTGGGCTGGGTGGGGGAAGGG - Intronic
950263401 3:11558451-11558473 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
950509865 3:13419784-13419806 TTCTGGGTTGTGCGGGAGGAGGG - Intronic
950560351 3:13717809-13717831 CTGTGGGTGGGGTGGGGGAGTGG + Intergenic
950576363 3:13834430-13834452 CTGTGGGTTGGGTGCGTGCTGGG + Intronic
950674448 3:14546129-14546151 CTGTGGGTGGGGTAGAGGGAGGG + Intergenic
950715193 3:14842837-14842859 CTGTGTGTTGGGTGTGAGAATGG + Intronic
950761682 3:15235550-15235572 CTGGGGGGTGGGTGGGAGCATGG + Intronic
950762415 3:15243789-15243811 GTGGGGGGAGGGTGGGAGGAGGG + Intronic
950882640 3:16335619-16335641 CTGTTGGAGGTGTGGGAGGAGGG + Intronic
951187603 3:19732384-19732406 GTGTGTGTTGGGTGGGGGGTGGG - Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951831174 3:26928907-26928929 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
952132191 3:30377601-30377623 CTGGGGGTTGAGGGGGAGGTGGG - Intergenic
952261738 3:31746820-31746842 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
952750450 3:36820833-36820855 CTGGGTGGTGGGTGGGAGTAAGG + Intergenic
953166114 3:40466246-40466268 GTGTGGATTGGGTTGGGGGATGG + Intergenic
953460284 3:43076468-43076490 CTGTAGGTGGGGTGGCAGCAGGG - Intergenic
953582668 3:44171580-44171602 GAGTGGGGTGGGTGGGAGGGTGG - Intergenic
953637137 3:44673006-44673028 CTGATGGGTGGGTGGGTGGATGG + Intergenic
953858321 3:46519308-46519330 CTGTGAGTTGGCTGGAAAGATGG - Intronic
953935371 3:47037275-47037297 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
954195947 3:48997322-48997344 CTATGTGTTGAGTGGGAAGATGG - Intronic
954222366 3:49162619-49162641 CGGTGGGGTGGGTGGGCGGGAGG - Exonic
954249883 3:49359004-49359026 CTGCTGGGTGGGTGGGAGGTGGG + Intergenic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954835014 3:53458818-53458840 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
955326098 3:58010136-58010158 GTGTGGGTTGGGGCAGAGGAGGG + Intronic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
955401817 3:58597362-58597384 CTTTGGATTGGCAGGGAGGAGGG + Intronic
956186898 3:66571260-66571282 CTGTGGGTTAGGTGGGGGTAGGG - Intergenic
956588867 3:70892623-70892645 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
956976785 3:74589954-74589976 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
957084618 3:75668688-75668710 TTGTGGGGTGGGTGGGTGTAGGG - Intergenic
957150314 3:76478172-76478194 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957306323 3:78462927-78462949 CTGTTGGCTGGGTGGGGGGTTGG - Intergenic
957367299 3:79242977-79242999 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957556748 3:81771895-81771917 GTGTGTGTTGGGTGGGGGGGGGG + Intergenic
958026035 3:88050264-88050286 CTGGGGGTTGGGTGTGATTAGGG - Intergenic
958635582 3:96739950-96739972 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
958940278 3:100304636-100304658 CTGGTGCTTGGGTGGGAAGAAGG - Intronic
959119657 3:102217572-102217594 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
959295306 3:104528131-104528153 TTGTGGGATGGGGGGCAGGAGGG - Intergenic
959894617 3:111592122-111592144 GTGTGTGTTTGGTTGGAGGAGGG + Intronic
960047509 3:113212067-113212089 CTGTTGGTTCGGGGAGAGGAGGG + Intronic
960064332 3:113354480-113354502 CTGTGGGTTGCATGGGAGCAAGG + Intronic
960465863 3:117996535-117996557 CGGTGAGTGGGGTGGGGGGAGGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961823826 3:129588563-129588585 CTGTGGGCTGGGTGGGCGTGGGG - Intronic
962147446 3:132855399-132855421 CTGTAGGCTGTGTGGGAGCAGGG - Intergenic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962305947 3:134286236-134286258 CAGTGGGGGGGGTGGGGGGAGGG + Intergenic
962346726 3:134624176-134624198 GTGTGGAGTGGGTGGGAGGTGGG - Intronic
962741222 3:138363821-138363843 CTGTGGTTTGGGGGGGGGGGGGG - Intronic
962938143 3:140100629-140100651 CAGTGGGCTGTGTGGGAGGCTGG - Intronic
963992727 3:151671953-151671975 TTTTTGGTTGGGTGGGGGGATGG + Intergenic
964023739 3:152046123-152046145 CTTTGGATTGGGTGGGATTATGG - Intergenic
964085158 3:152808304-152808326 CTGTGTGTTGGGTGGCATAATGG + Intergenic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
965296675 3:166955799-166955821 CTGTGAGTTGAGTGGGAGCAGGG - Intergenic
965384222 3:168026615-168026637 ATGTGCATGGGGTGGGAGGAAGG - Intronic
965499460 3:169440539-169440561 TTGGGGATGGGGTGGGAGGAGGG + Intronic
965637473 3:170798273-170798295 CTGGGGGTTGAGAGGGAGAAGGG + Intronic
965941479 3:174187856-174187878 TTGTGGGTTTGTTGGGAGGGTGG + Intronic
966181745 3:177195370-177195392 GTGTGGGTTGGGTGGTATCATGG - Intronic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967851623 3:194086893-194086915 CTTTGGGCTGGATGGGAGGGGGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967902539 3:194470984-194471006 CTCTGGGCTGGGTGGGAGTGAGG + Intronic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968373377 4:15948-15970 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
968375201 4:34376-34398 ATGGGGGGAGGGTGGGAGGAGGG - Intergenic
968592129 4:1464570-1464592 CCGTAGGCTGTGTGGGAGGAAGG + Intergenic
968650287 4:1757714-1757736 GTGGGGGTTGGGTGGGGGGATGG - Intergenic
968657310 4:1784178-1784200 CTGGGGGTTGCTTGGGAGGCAGG + Intergenic
968702954 4:2065331-2065353 CCTTGGGCTGGGTGGGAAGAGGG + Exonic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
968894055 4:3388567-3388589 CTGGGGGGTGGGTGGGAGCCAGG - Intronic
968926622 4:3551737-3551759 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
969263248 4:6046779-6046801 CTGTGGGTCGGGCGTGGGGAGGG + Intronic
969441129 4:7217332-7217354 CTGTGGGGTGGATGAGTGGATGG + Intronic
969462925 4:7338269-7338291 ATGTCGGTTGGATGGAAGGATGG + Intronic
969462935 4:7338312-7338334 ATGTCGGTTGGATGGAAGGATGG + Intronic
969462955 4:7338405-7338427 ATGTCGGTTGGATGGAAGGATGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969803293 4:9586586-9586608 ATGTGGGTTGGGTGGGCTGGAGG + Intergenic
970093951 4:12441511-12441533 CTGTGGGCAGGCTGGGTGGAGGG - Intergenic
970842275 4:20488474-20488496 ATGGGGGTGGGGTGGGAGAATGG - Intronic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971354478 4:25882668-25882690 TTGGGGGTGGGGTGGGACGAGGG + Intronic
972816177 4:42648359-42648381 CGGCGGGTGGGGTGGGGGGAAGG + Intronic
972911984 4:43828745-43828767 CTGTGAGTTGAATGGGAGGCTGG - Intergenic
972960755 4:44448852-44448874 CCGTGGGGAGGGCGGGAGGAGGG + Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973651021 4:52997277-52997299 TTGGGGCTTGAGTGGGAGGAGGG - Intronic
974468601 4:62290673-62290695 CTGGGGGTAGAGTGGGAGGTAGG + Intergenic
974483128 4:62471615-62471637 TTGTGGGTGGGGTGAGGGGAGGG - Intergenic
974901854 4:68009055-68009077 TTGTCGGATGGGTGGGGGGAGGG - Intergenic
975216763 4:71764447-71764469 ATGTGGTTTGTGTGAGAGGAGGG + Intronic
975515307 4:75240834-75240856 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
975713796 4:77186810-77186832 ATGAGTGTGGGGTGGGAGGAGGG - Intronic
975767789 4:77687188-77687210 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
976127837 4:81853220-81853242 CTGTGGGTAGGGTAGGAGTTGGG - Intronic
976441136 4:85076075-85076097 CTGTGTGTTGGGTGGGGGGCAGG - Intergenic
976516329 4:85971750-85971772 CCGTGGGTGGGGTGGGAGTGGGG - Intronic
976813990 4:89125343-89125365 CTCTGTGTTGGGAGGGAGAAAGG + Intergenic
977754877 4:100656867-100656889 TAGTGAGTTGGTTGGGAGGAAGG + Intronic
977754938 4:100657515-100657537 TAGTGAGTTGGTTGGGAGGAGGG - Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978370950 4:108029185-108029207 CTCTGTGTTGGCTGAGAGGAGGG - Intronic
979237600 4:118420030-118420052 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
979499148 4:121418932-121418954 CTCTGGGTTGTGTGGGAGCTGGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980761451 4:137239056-137239078 CAGTGGGCTGTGTGGGAGCAGGG - Intergenic
981473256 4:145161234-145161256 CTGTGGTTTGGGTGATACGAGGG - Intronic
981713934 4:147733985-147734007 ATGTGTGTTGGGTGGGAAGTAGG + Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983019424 4:162656460-162656482 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
983251588 4:165351909-165351931 CTGTGGGCTGAGTGGGAGTGGGG - Intergenic
983346151 4:166527240-166527262 CTGTAAGTGGGGTGGGAGGGTGG - Intergenic
983932612 4:173469729-173469751 CTGAAGGATGAGTGGGAGGATGG - Intergenic
984190634 4:176601345-176601367 CTGCGGGCTGCGTGGGAGCAGGG - Intergenic
984368279 4:178827444-178827466 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
984438638 4:179736846-179736868 CTTGTGGTGGGGTGGGAGGATGG - Intergenic
985092871 4:186381805-186381827 CTTTGGTTTGGGTGGGAGCTGGG + Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985217784 4:187672042-187672064 CTTTGGTTTGGGTGGGAGCTGGG - Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985432984 4:189899474-189899496 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
985446354 4:190022885-190022907 TTGTGGGGTGGGTGGGTGCAGGG + Intergenic
985459842 4:190094668-190094690 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
985905441 5:2831507-2831529 GTGTGCGGTGGGTGGGAGGGAGG + Intergenic
986323221 5:6650787-6650809 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
986953654 5:13123295-13123317 TTGTGGGATGGGTTGGAGGAAGG + Intergenic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
987750285 5:22030110-22030132 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
987893826 5:23918545-23918567 TTGTGGGGTGGGGGGAAGGAGGG + Intergenic
988002211 5:25363070-25363092 CTGTGGGCTGCGTGGGAGCTGGG + Intergenic
988086567 5:26481897-26481919 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
988226260 5:28415001-28415023 CTAAGGGTTGGGGGGGAGGAAGG + Intergenic
988348533 5:30070632-30070654 AAGTGGGGAGGGTGGGAGGAGGG - Intergenic
988404974 5:30812471-30812493 CTGTGTCTTGGGAGTGAGGATGG + Intergenic
988456702 5:31393265-31393287 CATTGGGTTGGGTAGGAGGCGGG + Intergenic
988483500 5:31649015-31649037 CTCTGGGTTGGGGGGCAGGAGGG - Intronic
988687086 5:33535748-33535770 CTGGGGATTGGATGTGAGGAGGG + Intronic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989254196 5:39349018-39349040 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
989375212 5:40754053-40754075 CAGTGGTTTGGGTTGGAAGATGG - Intronic
989467310 5:41772198-41772220 ATGTGGGTTGGTTGGGGAGAAGG + Intronic
989756737 5:44964246-44964268 TTATGTGTTGGGTGGGATGATGG + Intergenic
990089171 5:52019609-52019631 TTGTGGGATGGGGGGGAGGGGGG + Intronic
990236427 5:53772830-53772852 ATGTGGGATGGGCGGGAGGAGGG + Intergenic
990365311 5:55064553-55064575 AAGTGGGGTGGGTGGGAGAAAGG + Intergenic
990771819 5:59255399-59255421 CTGTGGGGTGGAAGGGAGGCAGG + Intronic
991166951 5:63574720-63574742 ATGGGGGTGGGGTGGGGGGAAGG - Intergenic
991172997 5:63650352-63650374 CTGTGGGTGGGGTGACAGAAAGG - Intergenic
991633145 5:68677190-68677212 GTCTGGGATGGATGGGAGGATGG - Intergenic
992259578 5:74956350-74956372 CTCTTGGTTAGGTGGGAGGTTGG + Intergenic
992342531 5:75840127-75840149 TTGTGGGTTGGGGAGGGGGAGGG - Intergenic
992413648 5:76532470-76532492 CTGAGGATTGGGTGGGTGGGGGG + Intronic
992622832 5:78610509-78610531 CTGTGGTGTGCATGGGAGGATGG + Intronic
992950413 5:81852297-81852319 CTGTGGGGTGGGCGGGGGGGTGG + Intergenic
992952946 5:81878680-81878702 CTGTGGCCTGGCTGAGAGGAAGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993625087 5:90214205-90214227 TTGTGGGGTGGGTGGGGGGGGGG + Intergenic
993852020 5:93022239-93022261 CTGGGGGGTGGGTGGGGGGTGGG + Intergenic
993923518 5:93837124-93837146 TTGAGGGTGGAGTGGGAGGAGGG - Intronic
994369831 5:98955437-98955459 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
994526227 5:100908423-100908445 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995550802 5:113279228-113279250 ATGTGGGTTGGGTGGGAAACTGG - Intronic
995785433 5:115822713-115822735 CTGTGGGTGGGTTGGGGGCAAGG - Intergenic
996045223 5:118864377-118864399 TTGTGGGGTGGGGGGAAGGAGGG + Intronic
996241438 5:121208109-121208131 CTGTCGGGTGGGGGGGAGGGGGG - Intergenic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
996408035 5:123125998-123126020 GTGTGGGTGGGTTGGGGGGAGGG + Intronic
996644249 5:125795427-125795449 GTGTGTGTTGGGGGGGAGGTGGG - Intergenic
997291505 5:132739232-132739254 TTGGGAGTGGGGTGGGAGGAGGG - Intergenic
998247509 5:140520776-140520798 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
998369071 5:141649706-141649728 CTGTGGGTGGGGTGGAGGGCAGG - Intronic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
998690652 5:144584038-144584060 TTATGGGGTGGGTGGGGGGATGG - Intergenic
998786216 5:145711722-145711744 CTGTGTGTTGGGTGGGTTGGGGG + Intronic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
999188216 5:149728575-149728597 ATGAGTGTAGGGTGGGAGGAGGG + Intergenic
999210729 5:149886230-149886252 CGGAGGGTTGGGTGTGGGGAGGG + Intronic
999233397 5:150076213-150076235 ATGTGGGTTGGGTGGGAACCTGG - Intronic
999548115 5:152654104-152654126 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
999715425 5:154356370-154356392 CTGGGGGTTGGGTATGAGAAAGG + Intronic
999742687 5:154568549-154568571 CTGGGGGTGGGAGGGGAGGAGGG + Intergenic
999836069 5:155374362-155374384 CTCTGTTTTGGGTGGTAGGATGG - Intergenic
999964911 5:156798840-156798862 CTGTGTGTGGCGTGGGGGGATGG + Intergenic
1000956696 5:167552514-167552536 CGGCGGGTTGGGGGGAAGGATGG - Intronic
1000996456 5:167964072-167964094 CTGTGAATAGGCTGGGAGGAAGG - Intronic
1001161998 5:169327577-169327599 CAGGGGGAAGGGTGGGAGGAGGG + Intergenic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001602843 5:172940106-172940128 CTGTGGGTGGGCTGGAGGGAGGG + Intronic
1002053377 5:176584526-176584548 CTGGGGGCTGGGTGGGCTGAGGG + Exonic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002570740 5:180137980-180138002 CTGTGGGCTCGGTGGGGGGTGGG + Exonic
1002738031 5:181411995-181412017 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003469834 6:6419152-6419174 GTTTGGGGTGGGTGGGAGAAGGG - Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1004817693 6:19330552-19330574 ATGGGGGTGGGGTGGGAGGTAGG + Intergenic
1004828551 6:19451120-19451142 CAGGGTGGTGGGTGGGAGGAGGG - Intergenic
1005177642 6:23064813-23064835 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1005298065 6:24446028-24446050 CTGTCAGTTGGGAGGCAGGATGG - Intronic
1005311347 6:24562508-24562530 CTCAGGGTGGAGTGGGAGGAGGG - Intronic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005697828 6:28367627-28367649 GTGTGTGTTGGGTGGTAGGGTGG - Exonic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006073853 6:31516533-31516555 CCATGGGTTGGGAGGGAGAATGG + Intergenic
1006616013 6:35327455-35327477 CTGTGGCTTGTATGTGAGGATGG + Intergenic
1006657532 6:35608580-35608602 CGGTGGCTGAGGTGGGAGGATGG + Intronic
1006669180 6:35719036-35719058 CTGTGAGTTGGGAGGGGGCAAGG - Intronic
1007100047 6:39239821-39239843 CTGAGGATTGGTTGGGAGGCGGG + Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007889843 6:45278124-45278146 CAGTGGGTGGGGTCGGGGGAGGG + Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008503233 6:52204418-52204440 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1008596949 6:53052046-53052068 TTGTGGGGTAGGTGGGACGAGGG - Intronic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008672812 6:53790837-53790859 CTGTTAGTTGGGTTGTAGGAGGG - Intergenic
1008991962 6:57613750-57613772 CAGTGGCTTGTGTTGGAGGAGGG + Intronic
1009180564 6:60512698-60512720 CAGTGGCTTGTGTTGGAGGAGGG + Intergenic
1009303141 6:62052621-62052643 GTGGGGGTTGGGGTGGAGGAGGG + Intronic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1009589114 6:65643220-65643242 CTGTGGGCTGTGTGGGAGCAGGG + Intronic
1009869770 6:69439685-69439707 TTGTGGGGTGGGTGGGAGGGGGG - Intergenic
1010027789 6:71239843-71239865 CTGTGGGTTGCTTGGGAGTGGGG + Intergenic
1010198875 6:73265569-73265591 CTGTGAGCTGGATTGGAGGAAGG + Intronic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010444957 6:75939344-75939366 TTGTGGGGTGGGGGGGAGCAGGG - Intronic
1010782521 6:79960077-79960099 TTGTGGGGTGGGTGGGGGGAGGG + Intergenic
1010877296 6:81123392-81123414 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1011713476 6:90079279-90079301 TTGTGTGTTTGGTTGGAGGAGGG - Intronic
1012113840 6:95268450-95268472 ATGTGGGTTAAGTGTGAGGAAGG - Intergenic
1012380325 6:98613252-98613274 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1012807895 6:103918026-103918048 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1013385713 6:109628311-109628333 TTGTGAGTAGGGTGGGAGCAAGG - Intronic
1013450101 6:110272113-110272135 CGGGGGAATGGGTGGGAGGAGGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1013809358 6:114027089-114027111 CTGTGGGTTGTTTGAGAGCAAGG + Intergenic
1013856654 6:114581151-114581173 CTGTGGGCTGTGTGGGAGTGGGG + Intergenic
1014973445 6:127848063-127848085 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1015080521 6:129219824-129219846 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1015497062 6:133893180-133893202 CTGTGGGGTTGGTGGAAGGGCGG - Exonic
1015739519 6:136438832-136438854 CTGGGGGTTGGGGGGAAGGGAGG - Intronic
1016638534 6:146322747-146322769 CTGTGGGGTGGGTGGAGGGCGGG - Intronic
1016681371 6:146833194-146833216 TTGTGTGTTGGGTGGGTGGCAGG - Intergenic
1017783428 6:157734394-157734416 CTGGGGATTGGATGGCAGGATGG + Intronic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1017956039 6:159178565-159178587 GTCTGGGGTGGATGGGAGGAAGG - Intronic
1018077706 6:160231323-160231345 CTTTGGGTTGGGAAGAAGGACGG - Intronic
1018203522 6:161416039-161416061 CTGCGCCTGGGGTGGGAGGATGG - Intronic
1018273155 6:162102182-162102204 CTGGGGGATGGGTGGGGGGACGG - Intronic
1018755257 6:166843072-166843094 CTGTGGGCTGCATGGGAGCAGGG + Intronic
1018923766 6:168193149-168193171 CCGTGGGGTGGGAGAGAGGACGG + Intergenic
1019243132 6:170687554-170687576 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1019298345 7:290586-290608 CTGCGGGATGGGGGGAAGGACGG + Intergenic
1019328365 7:450789-450811 CTGTGGGTGGGTTGGGGGGTGGG - Intergenic
1019348324 7:541354-541376 CTGTGGGTGGGGTGGGGGTGGGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019704557 7:2491339-2491361 ATGGGGGATGGGTGGGTGGATGG - Intergenic
1019704588 7:2491446-2491468 TTGGGGGATGGGTGGGTGGATGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019902032 7:4028473-4028495 CTGGTGGTTGGGTGGGAGGCTGG + Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020358586 7:7303588-7303610 CTTTGGGTTGAGTGGGAGCTAGG - Intergenic
1020440403 7:8211152-8211174 CTGTGGGTTCTCTGGGAGGTTGG - Intronic
1021027570 7:15687325-15687347 TGGTTGGGTGGGTGGGAGGAAGG + Intergenic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1021673950 7:23061694-23061716 TTGGGGGGGGGGTGGGAGGAGGG + Intergenic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1021806678 7:24364140-24364162 CTGGAGGCTGGGTGGAAGGATGG - Intergenic
1021827611 7:24571497-24571519 CTGGGGTTGGGGTGGGAGGTAGG - Intergenic
1022091974 7:27113856-27113878 GGGTGGGGTGGGTGGGAGGGGGG - Intronic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022340524 7:29463421-29463443 CTGTGGGGTGGGTGGAAGCATGG - Intronic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022543342 7:31160311-31160333 ATGTGGGAGGGGTGGGAGGTGGG - Intergenic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023071521 7:36439598-36439620 CTGTGTGTGGGGTGGGATAAAGG + Intronic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023582948 7:41701219-41701241 CTGTGGCTTGGCTGGGTGGAGGG - Intronic
1023806443 7:43876229-43876251 CCTTGGGTTGGGCGGGAGCAAGG + Exonic
1024288321 7:47779852-47779874 CCATGGGCTGGGTGGGAGAAAGG + Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1025072804 7:55915699-55915721 CTGTGGTTGGTGTGGAAGGAGGG + Intronic
1025165199 7:56706244-56706266 GTGTTGGTTGGTTGGGGGGAGGG - Intergenic
1025581304 7:62721828-62721850 CTGTTGGGGGGGTGGGGGGAGGG + Intergenic
1025581774 7:62728743-62728765 CTGTTGGGGGGGTGGGGGGAGGG - Intergenic
1025762749 7:64409850-64409872 CTGAGGGATGGGTGACAGGAGGG + Intergenic
1025839845 7:65136184-65136206 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1025883221 7:65559781-65559803 CTTGGGGTGGGGTGGGGGGAGGG + Intergenic
1025886273 7:65597043-65597065 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1025890225 7:65642825-65642847 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1026015761 7:66669456-66669478 CTGTGGGATGGGTGGCAGGGAGG + Intronic
1026112306 7:67468261-67468283 CAGTGGGGTGGTTGGGCGGAGGG - Intergenic
1026264319 7:68783173-68783195 GTGGGGGTGGGGTGGGGGGATGG - Intergenic
1026767770 7:73171381-73171403 GGGTGGGCTGGGTGGGAGGGGGG - Intergenic
1026840976 7:73669746-73669768 GGGAGGGTTGGGTGGGAGAAAGG + Intronic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1027079405 7:75221269-75221291 GGGTGGGCTGGGTGGGAGGGGGG + Intergenic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027529481 7:79312887-79312909 CGGTGGGTGGAGGGGGAGGAGGG - Intronic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027691707 7:81354708-81354730 CTGTAGGTTGTGTGGGAGTGGGG - Intergenic
1027906794 7:84195514-84195536 CAGGGGGTTTGTTGGGAGGAGGG - Intronic
1027967943 7:85038043-85038065 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1028577654 7:92370171-92370193 CTGTGGGATGGGTGGCTGGCAGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028971927 7:96868690-96868712 CAGTGGGTTGTATGGGAGAAAGG + Intergenic
1028994564 7:97085892-97085914 AGGTGGGCTGGGTGGGAGGCGGG - Intergenic
1029045984 7:97629228-97629250 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1029069457 7:97883411-97883433 ATGTGGGTTGGGTGGGCTGGAGG - Intergenic
1029317266 7:99726095-99726117 CTTTGGGTTGGGAAGAAGGATGG - Intronic
1029388627 7:100259852-100259874 GGGTGGGCTGGGTGGGAGGAGGG + Intronic
1029491087 7:100870475-100870497 CTGTGGGGTGGGTGGGACGTGGG + Intronic
1029630738 7:101748475-101748497 CTGAGGCTCGGGTGGGGGGAGGG + Intergenic
1029909368 7:104128669-104128691 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1030007385 7:105132649-105132671 CCGTGGGCTGGGTGAGGGGAAGG - Intronic
1030009432 7:105151734-105151756 CTCTGGGTTGGCTGGCACGATGG + Intronic
1030083060 7:105793959-105793981 GGGTGGGGTGGGTGGGTGGATGG - Intronic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030555312 7:111017439-111017461 ATGTGGGTTAGCTGGAAGGAGGG + Intronic
1030590157 7:111470721-111470743 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1030624140 7:111825382-111825404 CTGTATTTTGGGTGGGAGGGAGG - Intronic
1031740089 7:125418652-125418674 CTTTGGGTTGAGTGGGAGCTGGG + Intergenic
1031796913 7:126186343-126186365 CTGTGGGCTGCATGGGAGGTGGG - Intergenic
1031969691 7:128055180-128055202 CAGGGGGTTGGGAGGCAGGAAGG + Intronic
1032401303 7:131626226-131626248 AGGTGGGTTTGGTGGGAGCAGGG - Intergenic
1032578471 7:133081369-133081391 GTGGGGAGTGGGTGGGAGGAGGG + Intronic
1032895310 7:136244090-136244112 CTGTTGGGAGGTTGGGAGGAAGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1033036674 7:137882102-137882124 GTGTGGCTTGGAAGGGAGGATGG + Intronic
1033046044 7:137962880-137962902 CTGGGGGATGAGTGCGAGGATGG - Intronic
1033157345 7:138968186-138968208 CGGTAGGTGGGGTGGGAGGAGGG + Intronic
1033281477 7:140009583-140009605 GTGTGGGGTGGGTGTGGGGAAGG - Intronic
1033440448 7:141373643-141373665 ATGTGTGTTGGGGGGGTGGAGGG - Intronic
1033442838 7:141395830-141395852 CAGTGGTTTGTGTGGGAGAAAGG - Intronic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1033955373 7:146841363-146841385 AAGGGGGTTGGGTGGGGGGAAGG + Intronic
1034574785 7:151987613-151987635 CTGGGGGTGGGGTGGGCGGGAGG + Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034883614 7:154780856-154780878 GTGATGGTTGGGTGGGTGGAGGG + Intronic
1034943188 7:155245163-155245185 CCCTGGGATGGGTGAGAGGAGGG - Intergenic
1034964531 7:155383030-155383052 TTGGGGGCTGAGTGGGAGGACGG + Intronic
1034970952 7:155418750-155418772 CCGTGGGCAGGATGGGAGGAGGG - Intergenic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035258414 7:157646708-157646730 CTGTGGCTTGGGTGGCTGCATGG + Intronic
1035330170 7:158091667-158091689 TGGTTGGTTGGGTGGGTGGATGG + Intronic
1035477085 7:159151446-159151468 CTGAGGGTTGGGGGTGAGCAGGG - Intergenic
1035504990 8:120609-120631 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035987703 8:4453168-4453190 CTGTGTGTTGGGATGGAGGGGGG - Intronic
1036251699 8:7168077-7168099 ATGTGGGTTGGGTGGGCTGGAGG - Intergenic
1036365792 8:8119384-8119406 ATGTGGGTTGGGTGGGCTGGAGG + Intergenic
1036688797 8:10928415-10928437 AGATGGGTGGGGTGGGAGGAAGG + Intronic
1036769026 8:11566094-11566116 CTGTGGGGTGGGGCTGAGGAGGG + Intergenic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1037149312 8:15616670-15616692 CTGTGCTGTGGGTGGCAGGAAGG + Intronic
1037481988 8:19313859-19313881 GTGTGCGTGGGGTGGGAGTAGGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037668872 8:20997426-20997448 TTGTGAGTTGGATGAGAGGATGG - Intergenic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1037874220 8:22531498-22531520 CTGAGGGTTGGATGTGAGGAAGG + Intronic
1037929213 8:22867639-22867661 CTTGGGGTGGGGTTGGAGGAGGG - Intronic
1037949020 8:23006940-23006962 CGGTGGCTTGGGGGGTAGGAAGG - Exonic
1038036050 8:23687929-23687951 AGGTGGGGTGGGTGGAAGGATGG - Intergenic
1038048568 8:23788284-23788306 CACTGTGTAGGGTGGGAGGAGGG + Intergenic
1038267460 8:26047730-26047752 CGGGGGGTTGGCTGGGAGGAGGG - Intergenic
1038486732 8:27940738-27940760 CAGATGGTTGGGTGGGTGGATGG - Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1038642277 8:29338106-29338128 TGTTGGGTTGGGAGGGAGGAGGG - Intronic
1038691094 8:29764333-29764355 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1039442223 8:37603000-37603022 CTGTGGGTGCTGTGGGAGCAAGG - Intergenic
1040438464 8:47416769-47416791 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040446399 8:47499786-47499808 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1041242599 8:55861046-55861068 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1041345813 8:56896766-56896788 CTGTTGGCGGGGTGGGGGGAGGG + Intergenic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1041748118 8:61231538-61231560 CAGGGAGGTGGGTGGGAGGAAGG - Intronic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1041839237 8:62249247-62249269 CGGTGGGGAGGGTGGGAGGCGGG - Intronic
1041889181 8:62849598-62849620 TTGTGGGGTGGGTGGGGGGGAGG - Intronic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1042645552 8:70982492-70982514 CTGGGGGCTGTGTGGGAGCAGGG - Intergenic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043769873 8:84184647-84184669 CCGTGGGAGGGGTGGGGGGAGGG - Intronic
1044249695 8:89991186-89991208 GGGTGGGTGGGGTGGGGGGACGG + Intronic
1044281317 8:90360478-90360500 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1044289112 8:90446959-90446981 CTGGGGATTGGGTGGAGGGAGGG - Intergenic
1044294697 8:90513875-90513897 CAGAGTGTGGGGTGGGAGGAGGG + Intergenic
1044444093 8:92253548-92253570 TTGTGGGGTGGGCGGGGGGAGGG + Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045282583 8:100761881-100761903 CTGTGGGATGCTTGGGAGGAAGG - Intergenic
1045430318 8:102107927-102107949 GTGTGGGTGGGGTGAGGGGAAGG - Intronic
1045935254 8:107671381-107671403 GTGAGGGTTGGGTTGGAGGATGG + Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1046687362 8:117242508-117242530 TTGTGGGATGGGTGGGTGGGAGG - Intergenic
1047175466 8:122536519-122536541 CTCTGGGTGGGGTGGGAGAATGG + Intergenic
1047180718 8:122585171-122585193 CTGTGGGGTGGGGGGGTGGGGGG - Intergenic
1047236617 8:123047426-123047448 CTTTGACTTGAGTGGGAGGAAGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048494251 8:134922156-134922178 GGTTGGGTTGGGTAGGAGGAGGG + Intergenic
1048564925 8:135585472-135585494 AAGTGTGGTGGGTGGGAGGAAGG - Intronic
1048837789 8:138537628-138537650 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1048987676 8:139743739-139743761 CTGTGGGGTGGGGGGCAGGCAGG + Intronic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049582286 8:143418227-143418249 CTGAAGGGTGGGTGGGAGGATGG - Intergenic
1049583301 8:143422263-143422285 CTGAGGACTGGGTGGGAGGGAGG + Intronic
1049773598 8:144394816-144394838 CTGTGGGATGGCTGTGGGGATGG + Intronic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049844943 8:144795676-144795698 AGGTGGGGTGGTTGGGAGGATGG + Intergenic
1049888412 9:44700-44722 CGATGGATTGGGTGGGAGTAGGG - Intergenic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1050165262 9:2758583-2758605 CTCTGGGTTGGGTGGCAGCAGGG + Intronic
1050400440 9:5247949-5247971 CTGTGGGTTGCATGGGAGCAAGG + Intergenic
1050624045 9:7484872-7484894 TGGAGGGTAGGGTGGGAGGAAGG + Intergenic
1051563888 9:18474072-18474094 CCGAGGGGTGGGTGGGTGGATGG - Exonic
1051696567 9:19774188-19774210 TGGTGGGTTGGGGAGGAGGAGGG + Intronic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052364547 9:27596973-27596995 TTGTGCTATGGGTGGGAGGAGGG + Intergenic
1052557998 9:30044871-30044893 CTGTGAGTTGGGGAGAAGGAGGG + Intergenic
1052713384 9:32085403-32085425 CTGTGTGTTGGGTAGTGGGAGGG + Intergenic
1052713561 9:32087832-32087854 CAGTGGGTGGGGTGGGGGAAGGG + Intergenic
1052758987 9:32570252-32570274 CAGTGGGTTGCAGGGGAGGAGGG - Intronic
1053050479 9:34957823-34957845 CCGGGGGTTGGGTGGGGGGAAGG - Intronic
1053801541 9:41767119-41767141 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054143658 9:61547707-61547729 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054189972 9:61979273-61979295 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054463434 9:65479042-65479064 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054648542 9:67609318-67609340 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054938522 9:70714635-70714657 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1054940213 9:70732628-70732650 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1055030617 9:71768889-71768911 CTGTGGATTGGGCGGGCGGGCGG + Intronic
1055042966 9:71895220-71895242 CTGTAAATGGGGTGGGAGGAGGG - Intronic
1055056638 9:72030069-72030091 TTGTTGGTTGGGTGGGTGGATGG - Intergenic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1055912038 9:81364094-81364116 CTGTGGGCTATGTGGGAGCAGGG + Intergenic
1056053556 9:82796490-82796512 CTGAGGGTAGGGTGGAAGAAGGG + Intergenic
1056280758 9:85039086-85039108 CCAAGGGTTGGGTGGGAGGGTGG + Intergenic
1056393780 9:86162946-86162968 TTGTGGGTTCGGCGGGGGGAGGG + Intergenic
1056490247 9:87099110-87099132 TTGGAGGTTGGGTGGGAGGAGGG + Intergenic
1056514875 9:87340618-87340640 CTCAGGGTTGGCTGGGAGAATGG - Intergenic
1056561984 9:87738550-87738572 CTGTCAGGGGGGTGGGAGGAGGG + Intergenic
1057302581 9:93895397-93895419 CTGTGGATTGGGGTAGAGGATGG - Intergenic
1057339073 9:94183082-94183104 CTCTGGGGTGGGTCGGGGGAGGG - Intergenic
1057453564 9:95187552-95187574 CAGTGGGCTGGGTGGGACCAAGG - Intronic
1057474689 9:95388471-95388493 CAGTGGGCTGGGTGGGACCAAGG + Intergenic
1057971385 9:99561608-99561630 CCCTGGGGAGGGTGGGAGGATGG - Intergenic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058906734 9:109488065-109488087 GTGTGGGGTCGGGGGGAGGAGGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059330779 9:113534105-113534127 CTGAGGGTTGGGTTGGATGCAGG + Intronic
1059404595 9:114092111-114092133 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1059706740 9:116830964-116830986 CTGTGGGTGGGTGGGGAGAAGGG - Intronic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060223935 9:121780256-121780278 CTGGGGGTGGGGTGGCAGGAGGG - Intronic
1060512296 9:124242910-124242932 GTGTGGGAGGGGTGGGAGGCAGG - Intergenic
1060533899 9:124367477-124367499 CTGTTACTTAGGTGGGAGGAGGG + Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1060882930 9:127131108-127131130 CTGTGGGCTGTGGGGGTGGAGGG + Intronic
1060975363 9:127762042-127762064 ATGGGGGTGGGGTGGGAGGAGGG - Intronic
1061043199 9:128151311-128151333 CTGTGTGTTGGGTGGCGGGGGGG + Intronic
1061077242 9:128349037-128349059 GTTGGGGTTGGGTGGGAGGGTGG + Intronic
1061301019 9:129705129-129705151 GTGCGGGGTGGGTGGGAGGCAGG - Intronic
1061488553 9:130933035-130933057 GAGGGGCTTGGGTGGGAGGAGGG - Intronic
1061507793 9:131041430-131041452 ATGTGTGGTGGGTGGGAAGATGG + Intronic
1061562627 9:131415948-131415970 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1061905694 9:133695726-133695748 CTGTTGGGTGGGTGGGTGGGTGG + Intronic
1061963060 9:133998123-133998145 ATGTGGGATGGTTGGAAGGAGGG - Intergenic
1062103758 9:134741607-134741629 AGGAGGGTGGGGTGGGAGGAGGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062266868 9:135690576-135690598 ATGAGGGTGGGGTGGGAGGTGGG - Intergenic
1062269776 9:135703113-135703135 CTGAGGGATGGGGGAGAGGATGG - Intronic
1062284855 9:135768336-135768358 ATGTGGGTTGGGGGGGGGGGGGG + Intronic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062500338 9:136849390-136849412 CCCCGGGTCGGGTGGGAGGAGGG + Exonic
1062542637 9:137048428-137048450 CTGAGGGTGGGGTGGAAGGATGG + Exonic
1062542692 9:137048582-137048604 TTGTGGGAGGGGTGGGAGTACGG + Exonic
1203453035 Un_GL000219v1:138451-138473 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1203574023 Un_KI270744v1:159774-159796 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
1203603321 Un_KI270748v1:36778-36800 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1185633487 X:1534849-1534871 GTGTGGGTAGGGTTGGAGGGAGG + Intronic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186344308 X:8675851-8675873 CGGGGGGTGGGGTGGGGGGAGGG - Intronic
1186515554 X:10164079-10164101 CTGTGTGTTGAGTGAAAGGATGG + Intronic
1186565136 X:10654427-10654449 ATCCGGGATGGGTGGGAGGAAGG + Intronic
1186690941 X:11974847-11974869 CTGTGGTGTGGGTGGAAGCAGGG + Intergenic
1186913920 X:14199465-14199487 CTGTCGGTGGGGTGGGGGGAGGG + Intergenic
1187108450 X:16269843-16269865 CGGTGGGTGGGGTGGGGGGAGGG - Intergenic
1187466462 X:19531960-19531982 CTATGGGGTGGGTGGGAACAGGG + Intergenic
1187483138 X:19676354-19676376 GTGGGGGCTGGGTGGGAGGCGGG + Intronic
1187607264 X:20899074-20899096 GTGAGGGTTGTGTGGGGGGAGGG + Intergenic
1187636544 X:21235474-21235496 GAGGGGGTAGGGTGGGAGGATGG + Intergenic
1187760778 X:22581539-22581561 CTGTGGGTGGGTTGGGGGCAAGG + Intergenic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1188760161 X:34017799-34017821 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1189939813 X:46109842-46109864 TTGTGGGGTGGGGGGAAGGAGGG + Intergenic
1190110051 X:47583489-47583511 CTGTGGGTGGGGTGGGACACAGG - Exonic
1190432680 X:50392975-50392997 TTTTGGGTTGGCTGGTAGGAGGG - Intronic
1190737757 X:53266888-53266910 CGGGGGGGTGGGTGGGGGGAAGG + Intronic
1191714131 X:64182533-64182555 CTGGGGGTTGGGTGGGGGATGGG + Intergenic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192597578 X:72427594-72427616 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
1192817259 X:74607184-74607206 AAGTGGGGTGGGTGGGAGGGAGG + Intronic
1193046551 X:77060565-77060587 CTGTGGTTGGGGTCGGAGGTAGG - Intergenic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1193817564 X:86122287-86122309 CTGTGGGCTGTGTGAGAGCAGGG - Intergenic
1193824099 X:86201286-86201308 GAGGGGGGTGGGTGGGAGGAGGG + Intronic
1193846888 X:86482987-86483009 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
1193853749 X:86572880-86572902 CAGAGTGGTGGGTGGGAGGAGGG - Intronic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194806816 X:98339328-98339350 GTGTGTGTGGGGTGGGAGAAGGG - Intergenic
1194932166 X:99901497-99901519 CTTTGGGTTGTGTGGGAGCTGGG - Intergenic
1194976405 X:100401257-100401279 CTGGTGGGTGGCTGGGAGGAAGG - Intronic
1195152054 X:102082131-102082153 ATGTGGGTTGTGTGGGAATAAGG - Intergenic
1195409204 X:104550617-104550639 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1195423283 X:104699162-104699184 CTGTGGACTTGGTGGGGGGATGG + Intronic
1195730967 X:107966948-107966970 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1195869689 X:109473048-109473070 ATGTGGGTGGGGTGGGGGCAGGG - Intronic
1196089748 X:111726905-111726927 CTGCAGCCTGGGTGGGAGGAGGG - Exonic
1196178486 X:112665846-112665868 CTGTGGTGTGGCTGGAAGGAGGG - Intronic
1196337835 X:114559281-114559303 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1196359000 X:114830841-114830863 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1196621291 X:117827592-117827614 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1197034675 X:121859483-121859505 CTGTGGGCTCTGTGGGAGTAGGG - Intergenic
1197120056 X:122880523-122880545 CTGTGGGCTGTGTGGGAGCAGGG + Intergenic
1197705647 X:129632699-129632721 TTGTGGGTTGGGTTGGGGGTGGG - Intergenic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1197977358 X:132180059-132180081 CAGAGGGTGGGGTGGGGGGAGGG + Intergenic
1198347238 X:135770641-135770663 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198349144 X:135787903-135787925 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198352956 X:135822440-135822462 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198354865 X:135839696-135839718 CTGTGGCTTGTGTGGTAGGCAGG - Intergenic
1198566961 X:137914854-137914876 ATGTGGGTAGGGTGAGGGGAGGG + Intergenic
1198652100 X:138874000-138874022 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1198719632 X:139602255-139602277 GTGTGTGTTGGGGGGGAGGGTGG + Intronic
1198977307 X:142351288-142351310 GTGTGGGTTGGAAGGGAGGGTGG - Intergenic
1198980083 X:142385736-142385758 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1199324466 X:146481138-146481160 TGGAGGGTTGGGTGGGAGAATGG - Intergenic
1199336367 X:146622486-146622508 CTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1199350174 X:146790817-146790839 TTGTGGGCTGGGTGGGTGGAAGG - Intergenic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200869053 Y:8077303-8077325 CTATGGGTTGGGTCGAAGTAGGG + Intergenic
1201145390 Y:11062316-11062338 CTGGGGAGTGGGTGGCAGGAGGG - Intergenic
1201249802 Y:12045357-12045379 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1201438541 Y:13985329-13985351 GTGTGGGGTGGGAGGGAGGGAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201446032 Y:14057379-14057401 GTGTGGGGTGGGAGGGAGGGAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202372041 Y:24205383-24205405 GTGAGGCTTGCGTGGGAGGAGGG - Intergenic
1202498744 Y:25464733-25464755 GTGAGGCTTGCGTGGGAGGAGGG + Intergenic