ID: 1075461536

View in Genome Browser
Species Human (GRCh38)
Location 10:122619755-122619777
Sequence GAGTGAGGGACGGAGGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075461536_1075461546 25 Left 1075461536 10:122619755-122619777 CCTGATACCTCCGTCCCTCACTC 0: 1
1: 0
2: 2
3: 30
4: 307
Right 1075461546 10:122619803-122619825 GCCATATCTGCATCCAGAAAAGG No data
1075461536_1075461542 3 Left 1075461536 10:122619755-122619777 CCTGATACCTCCGTCCCTCACTC 0: 1
1: 0
2: 2
3: 30
4: 307
Right 1075461542 10:122619781-122619803 CAAATACCCCAGATTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075461536 Original CRISPR GAGTGAGGGACGGAGGTATC AGG (reversed) Intronic
900124121 1:1062070-1062092 GGGAGAGGGACGGAGGGAACGGG - Intergenic
900174477 1:1285747-1285769 GTGTCAGGGACGGGTGTATCCGG + Intronic
901216547 1:7558443-7558465 GAGTGAGGGAAGCAGCTGTCTGG - Intronic
902030063 1:13415809-13415831 GAGGGAGGGAGGGAGGGATGAGG + Intronic
902612989 1:17608033-17608055 GAGGGAGGGAGGGAGGGAGCTGG + Intronic
904810016 1:33157368-33157390 GAGTGAGCCACGTAGGTATCTGG - Intronic
905591855 1:39170927-39170949 GCGTGAGGGAAAGAGGTCTCAGG - Intronic
905716731 1:40158449-40158471 GAGGAAGGGAAGGAGGTATAAGG - Intergenic
906172682 1:43740854-43740876 GAGTGAGGGAGGGAGGAAGAGGG + Intronic
907689070 1:56645020-56645042 GAGTGAGGGGCGGAGGCGACAGG - Intronic
907704150 1:56818747-56818769 GAGTGAGGGACCCAGGGCTCAGG + Intronic
907913600 1:58848785-58848807 TAGTCAAGGACGCAGGTATCAGG - Intergenic
909959589 1:81823417-81823439 GAGAGAGGGACAGAGGTAGGGGG - Intronic
910551203 1:88477518-88477540 GAGAGAGGGAGTGAGGTCTCAGG - Intergenic
910667243 1:89738980-89739002 AAGTGAGGGGAGGAGGTATACGG - Intronic
912355098 1:109048430-109048452 GAGTGAGGGAGGGAGGGAGGAGG + Intergenic
912411032 1:109480849-109480871 GAGGGACTGAAGGAGGTATCAGG - Exonic
912911453 1:113763417-113763439 GAGTGAGGCATGGAGCAATCTGG - Exonic
915133689 1:153714436-153714458 GAGGGAGGGAGGGAGGGAGCCGG - Intergenic
915489512 1:156243349-156243371 GAGTGTGGGAGGGAGGTGTCAGG + Intronic
915662613 1:157416567-157416589 TAGTGAGGGAGGGAGGTGTCTGG - Intergenic
915663566 1:157424204-157424226 GTGTGAGGGACTGTGCTATCTGG + Intergenic
917029580 1:170674175-170674197 GAGAGAGAGAGAGAGGTATCAGG - Intronic
919935131 1:202246090-202246112 GAGGGAGGGAGGGAGGGATGGGG - Intronic
919935174 1:202246214-202246236 GAGAGAGGGAGGGAGGGATGGGG - Intronic
919935220 1:202246335-202246357 GAGAGAGGGAGGGAGGGATGGGG - Intronic
920965019 1:210694331-210694353 GAGTGAGGGCCGGGAGTAGCTGG - Intronic
921121318 1:212140050-212140072 AAGTGAGGGATGGAGGCATGTGG - Intergenic
921296913 1:213712709-213712731 CAGTGAGGGACGGTGGTATCCGG - Intergenic
922178865 1:223217984-223218006 GAGAGAGGGAGGGAGGTGCCAGG - Intergenic
922534958 1:226372876-226372898 GAATGAGGGACGGAGGTGGAGGG - Intronic
923093022 1:230753834-230753856 GAGGGAGGGAGGGAGGAAGCCGG - Intronic
923331722 1:232931523-232931545 GAGTGAGGCAAGAAGGCATCTGG + Intergenic
923375322 1:233356147-233356169 GAGTAGGGGAGGGAGCTATCAGG - Intronic
923486268 1:234434473-234434495 GAGTGAGGGATGAAGGTGCCAGG + Intronic
1064354786 10:14606667-14606689 GAGAGAAGGAAGGAGGGATCTGG - Intronic
1064984397 10:21195650-21195672 GAGAGAGGGAGGGAGGTATGTGG - Intergenic
1066456647 10:35577964-35577986 GAGTGAGCAATGCAGGTATCAGG - Intergenic
1067216611 10:44309434-44309456 GAGGGAGGGAAGGAGGTGGCGGG + Intergenic
1067435910 10:46277006-46277028 GGGAGAGGGAAGGGGGTATCTGG + Intergenic
1068069912 10:52183009-52183031 GATAGAGGGGAGGAGGTATCAGG + Intronic
1068575100 10:58676068-58676090 GAGTGAGGGATGGTGCTATCTGG + Intronic
1069655290 10:70083268-70083290 GTGTGTGGGAAGAAGGTATCTGG - Intronic
1070242007 10:74691508-74691530 GGGTGAGGGATGGAGGCAGCAGG + Intronic
1070356792 10:75647794-75647816 GAGAGAGGGACCAAGGTAGCTGG + Intronic
1071002082 10:80841948-80841970 CTGTGAGGGATGGAGCTATCTGG - Intergenic
1071062012 10:81581640-81581662 GAGTGAGGTACAGAGGCATTAGG + Intergenic
1071341401 10:84652134-84652156 GAATGAGGGACAGTGCTATCCGG - Intergenic
1073944078 10:108730288-108730310 GAGGGAGGGAGGGAGGTAGAGGG + Intergenic
1075455895 10:122584769-122584791 GAGTGAGGAAGGGAGGTGTCAGG - Intronic
1075456932 10:122590976-122590998 GAGTGAGGAATGGAGGTATCAGG - Intronic
1075458016 10:122597472-122597494 GAGTGAGGAAGGGAGGTGTCAGG - Intronic
1075461536 10:122619755-122619777 GAGTGAGGGACGGAGGTATCAGG - Intronic
1076199702 10:128548066-128548088 GAGGGAGGGACGGAGGGAAGGGG + Intergenic
1077097796 11:806484-806506 GAGGGAGGGATGGTGGTAGCTGG - Intronic
1077264684 11:1642814-1642836 GAGGGAGGGAAGGAGGGAACAGG - Intergenic
1077897008 11:6460591-6460613 GAGTGAAGGATGGAGGATTCAGG + Intronic
1078403420 11:11047221-11047243 GAGTGAGGGAAGGTGGTACAAGG + Intergenic
1078744621 11:14099875-14099897 GAGTGAGGGACAGAGGGAAGAGG + Intronic
1079355742 11:19729188-19729210 GACTGAGGGAAGGAGGGAACTGG + Intronic
1079496651 11:21052081-21052103 GAGTGAGCTATGTAGGTATCTGG + Intronic
1080318923 11:30983792-30983814 GAGTGAGGGAGAGAGACATCTGG - Intronic
1081600384 11:44488602-44488624 GAGGGAGGGAGGGAGGGAGCGGG - Intergenic
1081804174 11:45881281-45881303 GAGGGAGGGAAGGAGGTCTAGGG - Exonic
1082804612 11:57439797-57439819 CAGTGTGGGACGGAGGTTTATGG - Intergenic
1083375099 11:62214033-62214055 GAGTGAGGGTCCGAGGTTTCTGG + Intergenic
1084438230 11:69156353-69156375 GCGTGAGGAACAGAGGTCTCTGG - Intergenic
1086191125 11:84080337-84080359 GAGTGAGGGAAGGTAGTTTCAGG - Intronic
1088250433 11:107857227-107857249 GAGGGAGGGAGGGAGGGAACTGG + Intronic
1089004098 11:115076402-115076424 GAGTGAGGGAAGCAGGGAACTGG - Intergenic
1090467885 11:126951467-126951489 CAGTGTGAGAAGGAGGTATCAGG + Intronic
1090720348 11:129466992-129467014 CAGTGAGGGACGGTGCTATCTGG + Intergenic
1090811632 11:130249703-130249725 CAGTGAGGGACTGTGCTATCTGG + Intronic
1091213588 11:133885446-133885468 CAGTGAGGGACAGTGGTATCTGG - Intergenic
1091584361 12:1807620-1807642 GAGTGAGGGCTGGAGGCAGCAGG - Intronic
1092238237 12:6822709-6822731 GAGGGAGGGAGGGAGGGAGCAGG - Intronic
1095748587 12:45686830-45686852 GAGTGATGGACTAGGGTATCTGG - Intergenic
1097357685 12:58620600-58620622 GAGAGAGGGGAGGAGGTGTCAGG - Intronic
1097488375 12:60234616-60234638 CCGTGAGGGACGGTGCTATCTGG + Intergenic
1097619450 12:61922543-61922565 CTGTGAGGGACGGTGCTATCCGG + Intronic
1098797405 12:74908201-74908223 GAGAGAGGAAGGGAGGCATCAGG + Intergenic
1099385272 12:82006163-82006185 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1100862208 12:98818133-98818155 GAGGGAGGGAGGGAGGGAACTGG - Intronic
1101977997 12:109378789-109378811 GAGAGAGGGAGGGAGGGATAGGG + Intronic
1102090554 12:110183831-110183853 GAGTCTGGGATGGGGGTATCTGG - Intronic
1102162720 12:110782536-110782558 GAGTGAGCCATGAAGGTATCTGG + Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1102482190 12:113231583-113231605 GAGGCAGGGACTGAGGAATCTGG + Intronic
1102662706 12:114543821-114543843 GAGTGTGGGAGGGAGTTATTCGG + Intergenic
1104599360 12:130142088-130142110 GATAGAGGGAGGGAGGTGTCTGG - Intergenic
1105946993 13:25198532-25198554 GAGTGAGGGGCTGAGGGAGCTGG + Intergenic
1105949018 13:25213040-25213062 GGGTGAGGGAGGGAGGTGCCAGG - Intergenic
1106078327 13:26479723-26479745 GAGTGGGGGAGGGAAGTGTCAGG + Intergenic
1106360771 13:29028576-29028598 GAGTGAGGGAGAGAGCCATCTGG - Intronic
1106468017 13:30030260-30030282 GAGTCAGGGATGGAGGAGTCAGG - Intergenic
1107410702 13:40155973-40155995 GAGTGAGGGAGGGAGGGAGTTGG + Intergenic
1109001237 13:56808531-56808553 GAATGTGGGAGGGAGGTATGAGG + Intergenic
1109113750 13:58354943-58354965 GAGAGAAGGAAGGAGGTATCAGG - Intergenic
1109177904 13:59177696-59177718 GAGGGAGGGAGGGAGGGATCAGG + Intergenic
1113952086 13:114077644-114077666 GAGGGAGGGAGGGATGAATCCGG - Intronic
1115331241 14:32201262-32201284 GGGTCAGGGACGGAGGAACCCGG - Intergenic
1115359874 14:32488727-32488749 GAGTGAAGGACCGTGCTATCTGG - Intronic
1115929335 14:38473179-38473201 GAATGAGGGACTGGGGTATGAGG - Intergenic
1116599549 14:46902374-46902396 TAGTGAGGGAGGGAGGGAACAGG - Intronic
1117599937 14:57364851-57364873 CAGTGAGGGACGGTGCTATCTGG + Intergenic
1117650789 14:57902844-57902866 GAGGGAGTGATGCAGGTATCAGG - Intronic
1117938495 14:60935312-60935334 GAGGGAGGGAGGGAGGGATGGGG - Intronic
1119995233 14:79246327-79246349 GAGTGAGGGAAGAAAGTATGTGG - Intronic
1120564472 14:86038041-86038063 GAGTGATGAACTAAGGTATCTGG + Intergenic
1121697767 14:95927715-95927737 GAGAGAGGGACGGAGGGAGAGGG - Intergenic
1121697778 14:95927743-95927765 GAGAGAGGGACGGAGGGAAAGGG - Intergenic
1121697803 14:95927821-95927843 GAGAGAGGGACGGAGGGAGAGGG - Intergenic
1121697820 14:95927877-95927899 GAGAGAGGGACGGAGGGAGAGGG - Intergenic
1122425435 14:101602688-101602710 GAGTGAGGGAGGGAGGGAAGAGG + Intergenic
1122735487 14:103837493-103837515 GAGGGAGGGAGGGAGATAGCTGG - Intronic
1122938409 14:104970410-104970432 GAGTGAGGCAAGCAGGTGTCCGG + Intronic
1125044680 15:35231824-35231846 GAGTGAGGGGAGGAGGTGCCAGG + Intronic
1126940428 15:53759830-53759852 GAGGGAGGGAGGGAGGCAGCGGG - Intronic
1128561512 15:68671685-68671707 GTGTGAGGGACTGAGGTCTCTGG - Intronic
1129517712 15:76166646-76166668 GAGTGAGGGGTGGAGGGAGCCGG - Intronic
1130681570 15:86001566-86001588 GAGGGAGGGACGGAGGGAAAGGG - Intergenic
1131451582 15:92544703-92544725 TAGAGAGGGAAGGAGGTATGTGG + Intergenic
1131732765 15:95299483-95299505 GTTTGAGGGAATGAGGTATCAGG + Intergenic
1132327545 15:100984476-100984498 GAGGGAGGGAGGGAGGGATGGGG - Intronic
1132755875 16:1485126-1485148 GAGGGAGGGAGGGAGGGAACGGG + Intergenic
1133309542 16:4835187-4835209 GAGGCAGGGATGGAGGTAGCAGG - Intronic
1133733381 16:8595175-8595197 GGAAGAGGGAGGGAGGTATCAGG + Intergenic
1135795930 16:25442357-25442379 GTGGGAGGGAGGGGGGTATCCGG + Intergenic
1135937640 16:26794658-26794680 GAGTGAGCCATGGAGGCATCTGG - Intergenic
1137001469 16:35233966-35233988 GGGTGAGGGAAGGAGGTCCCTGG + Intergenic
1139318552 16:66094266-66094288 GAGTGAGCCAGGCAGGTATCTGG - Intergenic
1139415480 16:66805009-66805031 GAGTGAGGGAGGGAAGTAAAGGG + Intronic
1140191263 16:72819206-72819228 GAGGGAGGGAGGGAGGGAGCCGG - Intronic
1140686482 16:77438325-77438347 GAGGGAGGGAGGGAGGAATGGGG + Intergenic
1141105430 16:81229524-81229546 GAGAGAGGAACGGAGGGAACAGG - Intergenic
1141506009 16:84479255-84479277 GGGTGAGGGACAGAGGCATCTGG - Exonic
1141635387 16:85311512-85311534 GAGGGAGGGAAGGAGGTGCCGGG + Intergenic
1141882957 16:86872051-86872073 GAGTGAGGGAGGGAGGGACGAGG - Intergenic
1143254260 17:5544102-5544124 GAGGGAGGGAGGGAGGTGGCAGG - Intronic
1143289960 17:5820962-5820984 GAGTGGGGGAAGCAGGAATCGGG + Intronic
1144278794 17:13703346-13703368 GAGTGAGGAAGGAAGGTAGCGGG + Intergenic
1144329086 17:14207980-14208002 GGGTGGGGGCCAGAGGTATCCGG - Exonic
1144871022 17:18371009-18371031 GAGGGAGGGAGGGAGGGAGCCGG + Intergenic
1147331966 17:39704627-39704649 GAGAGTGGGAGGGAGGTGTCAGG + Intronic
1147752507 17:42744917-42744939 GAGGGAGAGGCGGAGGGATCAGG - Intronic
1147915030 17:43880894-43880916 GAGGGAGGGGCGGAGCTCTCAGG + Intronic
1148346818 17:46908740-46908762 GAGTGAGGCACGGAGGCCCCTGG - Intergenic
1149171999 17:53823012-53823034 TGGTGAGTGATGGAGGTATCAGG - Exonic
1149223722 17:54444297-54444319 GAGTTAGGGAGGGATGTAGCAGG - Intergenic
1149867896 17:60160911-60160933 GAGGGAGGGAGGGAGGAAGCAGG + Intronic
1150849034 17:68687069-68687091 GAGTGAGGCAGGGAGGGATTGGG - Intergenic
1150849213 17:68688343-68688365 GAGAGAGGGAGGTAGGTATATGG + Intergenic
1151396565 17:73826896-73826918 GACAGAGGGAAGGAGGAATCTGG + Intergenic
1151524701 17:74656701-74656723 GATTGATGGACAGAGGAATCAGG + Intergenic
1153946455 18:10022454-10022476 GAGTGGGGGAAGGATGTTTCTGG + Intergenic
1154101611 18:11479628-11479650 CAGTGAGGGAAGGTGCTATCTGG - Intergenic
1154400701 18:14034321-14034343 CACTGAGGGACTGAGGCATCAGG + Intergenic
1155553492 18:26992200-26992222 GAGTGAGGGGCTGAGGCATCTGG - Intronic
1157220397 18:45825220-45825242 GAGAGAGGGAGGGAGGAATAAGG + Intergenic
1158952050 18:62503907-62503929 GAGGGAGGGAAGGAGGTGTCAGG + Intergenic
1159283243 18:66314469-66314491 GATGGAGGGAAGGAGGAATCAGG - Intergenic
1159741638 18:72178587-72178609 GAGAGAGGGAAGGAGGTACCAGG + Intergenic
1160017263 18:75154438-75154460 GAGTGGGGGATGGGGGTAGCGGG - Intergenic
1160041262 18:75347757-75347779 GAGGGAGGGAGGGAGGTGCCAGG + Intergenic
1161142991 19:2659768-2659790 GAGGGAGGGAGGGAGGGATGAGG + Intronic
1161377038 19:3944909-3944931 GAGGGAGGGAGGGAGGAAGCTGG + Intergenic
1161955966 19:7495247-7495269 GAGGGAGGGAGGGAGGGATTTGG - Intronic
1162967281 19:14161892-14161914 GAGGCAGGGACAGAGGTGTCTGG + Intronic
1164744222 19:30599344-30599366 AAGGGAGGGAAGGAGGGATCAGG - Intronic
1164841758 19:31398083-31398105 GAGAGAGGGGAGGAGGTACCAGG - Intergenic
1165339583 19:35201372-35201394 GAGTGAGAGATGGAGATACCAGG - Intergenic
1165503254 19:36206976-36206998 GAGTGAGAAATGCAGGTATCTGG + Intronic
1165670264 19:37672381-37672403 GAGTGAGGGAGGGATGGATAGGG + Intronic
1166147830 19:40849609-40849631 GAGAGAGGCAGGGAGGAATCAGG + Intronic
1166222877 19:41376857-41376879 GAGTGAGGGACGTAGGTGGGTGG + Intronic
1166751702 19:45166947-45166969 GAGGGAGGGATGGAGGCAGCTGG - Intronic
1166979660 19:46625105-46625127 GAGGGAGGGACGGAGGGAGGAGG - Exonic
925625910 2:5841988-5842010 GAGGGAAGGACGGAGGGATGAGG + Intergenic
930406257 2:50960303-50960325 GAGGGAGGGAGGGAGGGATGAGG - Intronic
930808714 2:55519083-55519105 CAGTGAGGGTCTGAGGTAACCGG - Intergenic
931243894 2:60477040-60477062 GAGTGGGGCAGGGAGGCATCGGG - Intronic
931709603 2:64977182-64977204 GAGGGAGGGAGGGAGGGATGAGG - Intergenic
934678357 2:96265673-96265695 GAGTGGGGGGCGGAGGGATCGGG + Intronic
936508421 2:113126666-113126688 GAGGGAGGGAGGGAGGAAGCAGG - Intronic
938116203 2:128604276-128604298 GGGTGAGGGACGGAGGTCCCAGG + Intergenic
940527242 2:154832020-154832042 GAGAGAGGGAAGGAGGTGCCAGG + Intronic
941611994 2:167672986-167673008 GTGTGTGGGAGGGGGGTATCTGG + Intergenic
945409109 2:209488228-209488250 CCGTGAGAGACGGAGCTATCTGG + Intronic
945557606 2:211298664-211298686 GAGGGGAGGAGGGAGGTATCCGG + Intergenic
946716076 2:222556514-222556536 GAGTGAGGGAGGGAGGAGTGAGG - Intronic
947347532 2:229208765-229208787 GAGAGAGGGACGGAGGAGGCAGG + Intronic
947949918 2:234138212-234138234 GACTGAATGACGGAGGGATCGGG - Intergenic
948628313 2:239284302-239284324 GGGTGAGGGACAGAGGGAGCGGG + Intronic
1168744055 20:221292-221314 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1168765898 20:381438-381460 AAGCCAGGGACGGAGGTGTCCGG + Intronic
1170855405 20:20048936-20048958 CAGTGGGGGAAGGAGGTATGCGG + Intronic
1172884314 20:38221181-38221203 GAGGGAGGGACGGAGGGACGGGG + Intronic
1175226659 20:57448426-57448448 GGGTGAGTGACTGAGGTATGTGG - Intergenic
1175683420 20:61008493-61008515 GAGTGAGGGAGGGAGGGAATCGG - Intergenic
1175705991 20:61177119-61177141 GAGGGAGGGAGGGAGGAATGGGG + Intergenic
1175813325 20:61870470-61870492 CAGTGAGGGAAGAAGGGATCGGG - Intronic
1180186904 21:46144662-46144684 GAGAGAGGGAGGGAGGGATGGGG - Intronic
1181528284 22:23502302-23502324 GATAGAGGGATGGAGGGATCAGG - Intergenic
1182112874 22:27735708-27735730 GAGTGAGCCACGCAGATATCAGG - Intergenic
1182459067 22:30471589-30471611 GAGGGAGGAACGGGGGTACCTGG + Intronic
1182486342 22:30641302-30641324 GAGGGAGGGAAGGAGGGAGCTGG - Intronic
1183149911 22:36028953-36028975 GAGGGAGGGAGGGAGGGACCGGG + Intergenic
1183201264 22:36387318-36387340 GTCTGAGGCACGGAGGTAACGGG - Intronic
1184265076 22:43342460-43342482 GAGAGAGGGACAGAGATACCTGG - Intronic
1184984154 22:48118059-48118081 GAGTGGTGGGCAGAGGTATCTGG - Intergenic
1185114809 22:48926623-48926645 GAGGGAGGGAGGGAGGTAGGTGG - Intergenic
950768025 3:15288422-15288444 TAGGGAGGGATGGAGGTTTCAGG + Intronic
952090901 3:29884475-29884497 GAGGGAGGGAGGGAGGGAGCGGG - Intronic
952165401 3:30743366-30743388 GAGTGAGTGAAGGAGATATGTGG + Intronic
952755282 3:36860305-36860327 GTGTGAGGGACAGAGGTAGGAGG + Intronic
953111238 3:39941249-39941271 GAGTGAGAGAGGGAGATGTCAGG + Intronic
953288488 3:41637195-41637217 GGGTGAGGGAAGGAGGTAGAAGG - Intronic
953404103 3:42652053-42652075 GAGGGAGGGACTGAGTTATTGGG - Intergenic
955205819 3:56895076-56895098 GAGGGAGGGAGGGAGGTAGAGGG - Intronic
955527757 3:59838533-59838555 GAGTAAGAGATGGAGGGATCAGG - Intronic
955580104 3:60410169-60410191 GAGAGAGGCAAGGAGGTATCAGG + Intronic
956220026 3:66892971-66892993 CTGTGAGGGACGGTGCTATCCGG + Intergenic
958051566 3:88354041-88354063 GAGAGAGAGACAGAGGTGTCAGG - Intergenic
958107554 3:89096483-89096505 GTGTGAGGGCAGGAGGTATATGG - Intergenic
958479412 3:94627832-94627854 GAGCGAGGGAAGGAGGGATGTGG - Intergenic
960040265 3:113143398-113143420 GTGTGAGGGCTGGAGGTATCTGG + Intergenic
962277992 3:134030139-134030161 GAGGGAGGGAAGGAGGTGGCGGG + Intronic
964886214 3:161486208-161486230 GAGTGAGGGAGGGTGGTATATGG - Intergenic
966291804 3:178368283-178368305 GAGGGAGGAAGGGAGTTATCTGG - Intergenic
967186351 3:186948030-186948052 GAGTGAGGGAGGGAGGAGGCAGG + Intronic
968058528 3:195711325-195711347 GAGTGAGGTATGGAGGGACCTGG + Intergenic
968266231 3:197365506-197365528 TAGTGAGGGAAGAAGGCATCTGG - Intergenic
968583497 4:1405596-1405618 GAGGGAGGGAGGGAGGCCTCGGG + Intronic
968979395 4:3838581-3838603 GAGTGAGGGACAGAGGGAAGAGG + Intergenic
969573275 4:8022540-8022562 GAGGGAGGGACCGAGGTGGCAGG - Intronic
970446064 4:16124241-16124263 CAGTGAGGGTCGGGGGTAGCAGG + Intergenic
970708495 4:18833981-18834003 GAGAGAGGGAAGGAGGCACCAGG + Intergenic
971405298 4:26317292-26317314 GAGTGAGGGAATGAGCTATAAGG + Intronic
973696899 4:53499069-53499091 GAGCAAGGGAAGGAGGAATCAGG - Intronic
973765402 4:54157247-54157269 GAGGGAGGGAGGGAGGGAGCCGG + Intronic
974851839 4:67412933-67412955 CTGTGAGGGACGGAGCTATCTGG - Intergenic
975560695 4:75705634-75705656 GAGTGAGGGACAAAGGCATCAGG + Intronic
977671342 4:99698993-99699015 CTGTGAGGGATGGAGCTATCTGG + Intergenic
978090231 4:104706789-104706811 GAGTGAGGGACAGTGCTATCTGG + Intergenic
978391957 4:108236318-108236340 GAGTGAGGGAAGCAGGGAGCTGG + Intergenic
979124172 4:116946591-116946613 GAGTGAGAGGGGGAGGTACCAGG - Intergenic
981315426 4:143336295-143336317 GGGAGAGGGAGGGAGGGATCGGG + Intergenic
981688661 4:147481847-147481869 GTGTGAGGGACTGAGGTGTTTGG + Intronic
985171022 4:187150337-187150359 GAGAGAGGGCAGGAGGTGTCAGG + Intergenic
986399605 5:7368210-7368232 GAGAGAGAGGAGGAGGTATCGGG - Intergenic
986464158 5:8004800-8004822 GAGTGATGAACTGGGGTATCTGG + Intergenic
987477527 5:18409881-18409903 GAGAGAGGGAGGGAGGTGCCAGG + Intergenic
989609941 5:43281357-43281379 GAGTGAAGGACAGAGGAAACAGG + Intergenic
990215353 5:53525797-53525819 CAGTGAGGGAGGGAGGGAACGGG - Intergenic
991044415 5:62208239-62208261 GAGTGAGGGAGTGAGGCATTTGG - Intergenic
991299859 5:65119825-65119847 GAGGGAAGGAAGGAGGTAGCAGG - Intergenic
994957195 5:106546982-106547004 AAGGGAAGGAGGGAGGTATCAGG + Intergenic
995260286 5:110096035-110096057 GAGGGAAGGAAGGAGGTACCAGG + Intergenic
996090281 5:119344278-119344300 GAGAGAGGGGAGGAGGTACCAGG + Intronic
998389504 5:141778475-141778497 GAGTGAGGGAAGGAGGAGGCGGG + Intergenic
999451687 5:151683101-151683123 GAGGGAGGGAGGGAGGCATCAGG + Intronic
1000860479 5:166450724-166450746 CCGTGAGGGATGGAGCTATCCGG - Intergenic
1001111899 5:168903591-168903613 GAGTGAAGGACGGGGGCAGCAGG + Intronic
1002099011 5:176848192-176848214 GGCTGAGGGGCGGAGGGATCTGG - Intronic
1002556925 5:180049228-180049250 GAGTGAGGGAAGGAGGCAGAGGG - Intronic
1003268255 6:4585476-4585498 GAGTGAGGGTCAGGGGTATTGGG - Intergenic
1004311290 6:14547676-14547698 GAATGAGGGAAGGAGTTCTCAGG + Intergenic
1006211283 6:32397031-32397053 GAGTCAGGTACAGAGGCATCTGG - Intronic
1006264767 6:32911459-32911481 CAGTGAGGGTTGGGGGTATCAGG - Intergenic
1007387022 6:41527146-41527168 GAGTGAGTTAAGGATGTATCTGG - Intergenic
1007940977 6:45781195-45781217 GAGTGACGGAAGGAGGGGTCAGG + Intergenic
1008288363 6:49682462-49682484 GAGGGAGGGAGGGAGGGATGGGG - Intergenic
1015182853 6:130379390-130379412 GAGTGAGGGACAAAGGGAACAGG + Intronic
1016378597 6:143450084-143450106 GAGTGAGGGAAGGAAGTAAAAGG + Intronic
1016924912 6:149335022-149335044 GAGTGAGGGAAGGAGGGAGGCGG - Intronic
1017503502 6:155046743-155046765 GAGAGAGGCACAGAGGGATCAGG - Intronic
1018639028 6:165889965-165889987 GAGTGAGGGATGGAGGAGTGAGG - Intronic
1018639033 6:165889987-165890009 GAGTGAGGGAGGGAGGAGTGAGG - Intronic
1018970545 6:168525848-168525870 GACTGAGGGGCGGGGGTCTCAGG - Intronic
1019404720 7:877392-877414 GAGAGAGAGACGGAGGGAGCAGG - Intronic
1020502959 7:8946044-8946066 GGCTGAGGTAGGGAGGTATCTGG - Intergenic
1021086330 7:16424315-16424337 GAGTTAGAGAAGGAGGTATGAGG + Intergenic
1021099851 7:16575136-16575158 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1022332318 7:29391410-29391432 GAGAGAGGGAAGGAGGGACCAGG + Intronic
1023379417 7:39591579-39591601 GTGTGGGGGCAGGAGGTATCTGG - Intronic
1023465317 7:40448210-40448232 GAGGGAGGGAGGGAGGGAACTGG - Intronic
1023565833 7:41522866-41522888 GAGTGATGGAGGGTGGTATCAGG + Intergenic
1023736062 7:43237071-43237093 GAGGGAGGGAGGGAGGAAGCAGG + Intronic
1026851261 7:73724947-73724969 GAGTGAGCCATGTAGGTATCTGG + Intergenic
1027582811 7:80020070-80020092 CCGTGAGGGATGGAGCTATCCGG + Intergenic
1029261532 7:99306055-99306077 GAGTGAGGGAAGGAGGAGTGGGG - Intergenic
1030717180 7:112823111-112823133 GAGTGAGGGATTAAGGTATTAGG - Intronic
1031317340 7:120273589-120273611 GAGGGAGGCACGGAGGGATGGGG + Intergenic
1032996105 7:137448524-137448546 GAGTGAGGGAGGGAGGGAAGGGG + Intronic
1034950000 7:155290696-155290718 GAGTGAGGGGCGGAGGGGCCAGG - Intergenic
1035220994 7:157406514-157406536 GAGTGGGGGAGGGAGGCTTCTGG + Intronic
1036053430 8:5225599-5225621 AAGTGAGGAAAGGAGGGATCAGG - Intergenic
1036502745 8:9328700-9328722 GAGAGAGAGAGGGAGGTGTCAGG + Intergenic
1039689815 8:39851445-39851467 GAGTGGGGGAAGGTGGTATGGGG + Intergenic
1042036587 8:64540450-64540472 GAGGGAGGGAGGGAGGGAGCTGG + Intergenic
1043506309 8:80906751-80906773 GAGGGAGGGAGGGAGGGATTAGG - Intergenic
1044283439 8:90383389-90383411 GAGTGAGGGATGGAGGTGTAAGG - Intergenic
1047741756 8:127812188-127812210 GAGGGAGGGACGGAGGAAGGAGG + Intergenic
1048165629 8:132059167-132059189 GAGTGAGGGAGGGAGGGAAATGG - Intronic
1048752492 8:137696021-137696043 GAGGGAGGCAAGGAGGTTTCTGG - Intergenic
1051606081 9:18918804-18918826 GAGGGAGGAACGGAGGGATGTGG + Intergenic
1052231059 9:26153404-26153426 GAGGGAGGGACGGAGGGAGTGGG + Intergenic
1052282089 9:26744896-26744918 GAGTGAGGCTCGGGGGAATCAGG - Intergenic
1053135350 9:35647213-35647235 GAGGGAGGGAGGGAGGCTTCGGG - Intergenic
1053649904 9:40156749-40156771 GAGGGAGGGAGGGAGGAAACAGG + Intergenic
1053755835 9:41307177-41307199 GAGGGAGGGAGGGAGGAAACAGG - Intergenic
1054330403 9:63748483-63748505 GAGGGAGGGAGGGAGGAAACAGG + Intergenic
1054534677 9:66219454-66219476 GAGGGAGGGAGGGAGGAAACAGG - Intergenic
1055623137 9:78146657-78146679 GAATGAGAGAAGGAGATATCAGG + Intergenic
1060992522 9:127857094-127857116 GAGTGAGGGACAGATGTGGCAGG + Intergenic
1061187184 9:129061360-129061382 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1061255818 9:129453813-129453835 GATAGAGGGATGGAGGGATCAGG + Intergenic
1061348261 9:130043369-130043391 GTGTGAGGGACGGCGGGACCCGG + Intergenic
1062025429 9:134338130-134338152 CAGGGAGGGACAGAGGTGTCAGG + Intronic
1062332549 9:136051035-136051057 GAGGGAGGGAGGGGGGTCTCTGG + Intronic
1062538317 9:137030518-137030540 GAGAGTGGGAGGGAGGTAACGGG - Exonic
1186350344 X:8732777-8732799 GAGGGAGGGAGGGAGGGATGCGG - Intergenic
1187529606 X:20084541-20084563 GAGGGAGGGAGGGAGGGAACAGG - Intronic
1188101328 X:26091578-26091600 GAGTGAGGGACAGAGGAAGTGGG - Intergenic
1188942160 X:36253820-36253842 GGGTGAGGGGCTGTGGTATCTGG - Intronic
1189370903 X:40428271-40428293 GAGTCAGGGACAGGGGTCTCAGG + Intergenic
1189811591 X:44785767-44785789 GAATGAGGGAAGGAGGTAGTAGG + Intergenic
1190054455 X:47173708-47173730 GAGGGAGGGAGGGAGGGAACAGG - Intronic
1190902866 X:54695738-54695760 GAGTGTGGGGCTGAGGAATCAGG - Intergenic
1190959825 X:55235017-55235039 CTGTGAGGGACAGAGCTATCCGG - Intronic
1191130297 X:57000774-57000796 GACTGAGGGAGGGAGGAATAGGG - Intergenic
1192228396 X:69245850-69245872 CTGTGAGGGACGGTGCTATCCGG + Intergenic
1193562606 X:83037735-83037757 CTGTGAGGGACGGTGCTATCCGG + Intergenic
1195961649 X:110393519-110393541 GAGTGAGGGACAGAGGGACTTGG - Intronic
1196886602 X:120251453-120251475 GAGTGAGGGCGGGAGGAATATGG - Intronic
1197471576 X:126869729-126869751 GAGTGATGGCCTCAGGTATCTGG - Intergenic
1197614371 X:128675237-128675259 CAGTGAGGGACAGTGCTATCTGG - Intergenic
1198362284 X:135907309-135907331 TTGTGAGGGACGGTGGAATCTGG - Exonic
1199501322 X:148509933-148509955 GTTTGAGGGACGGAGGAAGCAGG - Intronic
1199859969 X:151792617-151792639 TAGTGAGGGATGGAGGTAGCAGG - Intergenic