ID: 1075462179

View in Genome Browser
Species Human (GRCh38)
Location 10:122624159-122624181
Sequence CTCGGTTGCATCCTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075462171_1075462179 14 Left 1075462171 10:122624122-122624144 CCTAGGGCTGCACCTTGCCAGGC 0: 1
1: 0
2: 1
3: 103
4: 544
Right 1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG No data
1075462174_1075462179 2 Left 1075462174 10:122624134-122624156 CCTTGCCAGGCAGCTGGGAGCTG 0: 1
1: 1
2: 7
3: 205
4: 1935
Right 1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG No data
1075462169_1075462179 20 Left 1075462169 10:122624116-122624138 CCAGGTCCTAGGGCTGCACCTTG No data
Right 1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG No data
1075462176_1075462179 -3 Left 1075462176 10:122624139-122624161 CCAGGCAGCTGGGAGCTGGTCTC 0: 1
1: 0
2: 2
3: 30
4: 318
Right 1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG No data
1075462167_1075462179 28 Left 1075462167 10:122624108-122624130 CCCAAGAACCAGGTCCTAGGGCT 0: 1
1: 0
2: 2
3: 8
4: 101
Right 1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG No data
1075462168_1075462179 27 Left 1075462168 10:122624109-122624131 CCAAGAACCAGGTCCTAGGGCTG 0: 1
1: 0
2: 3
3: 23
4: 187
Right 1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075462179 Original CRISPR CTCGGTTGCATCCTGCTGCA GGG Intronic
No off target data available for this crispr