ID: 1075464174 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:122639049-122639071 |
Sequence | TGGGAAGCTCCAGCCATGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1075464174_1075464176 | -10 | Left | 1075464174 | 10:122639049-122639071 | CCATCCATGGCTGGAGCTTCCCA | No data | ||
Right | 1075464176 | 10:122639062-122639084 | GAGCTTCCCACAGCTCCACCAGG | No data | ||||
1075464174_1075464177 | -6 | Left | 1075464174 | 10:122639049-122639071 | CCATCCATGGCTGGAGCTTCCCA | No data | ||
Right | 1075464177 | 10:122639066-122639088 | TTCCCACAGCTCCACCAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1075464174 | Original CRISPR | TGGGAAGCTCCAGCCATGGA TGG (reversed) | Intronic | ||
No off target data available for this crispr |