ID: 1075464174

View in Genome Browser
Species Human (GRCh38)
Location 10:122639049-122639071
Sequence TGGGAAGCTCCAGCCATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075464174_1075464176 -10 Left 1075464174 10:122639049-122639071 CCATCCATGGCTGGAGCTTCCCA No data
Right 1075464176 10:122639062-122639084 GAGCTTCCCACAGCTCCACCAGG No data
1075464174_1075464177 -6 Left 1075464174 10:122639049-122639071 CCATCCATGGCTGGAGCTTCCCA No data
Right 1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075464174 Original CRISPR TGGGAAGCTCCAGCCATGGA TGG (reversed) Intronic
No off target data available for this crispr