ID: 1075464175

View in Genome Browser
Species Human (GRCh38)
Location 10:122639053-122639075
Sequence GCTGTGGGAAGCTCCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075464175_1075464177 -10 Left 1075464175 10:122639053-122639075 CCATGGCTGGAGCTTCCCACAGC 0: 1
1: 0
2: 3
3: 31
4: 289
Right 1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075464175 Original CRISPR GCTGTGGGAAGCTCCAGCCA TGG (reversed) Intronic
900357937 1:2273697-2273719 GCTGGGGGAGGCTGCAGTCACGG - Intronic
901866258 1:12109014-12109036 GCTCTGAGAAGCTTCAGGCATGG + Intronic
903173462 1:21567504-21567526 GCAGGGAGAGGCTCCAGCCAGGG - Intronic
904586692 1:31584690-31584712 GCTGTGGGAAGCACCTCCCCTGG - Exonic
905181441 1:36169582-36169604 TCTGTGGGAAGCTTCATCTAAGG - Intronic
905269194 1:36775855-36775877 TCTGCGGGAAGCTCCCGCCCTGG + Intergenic
905482180 1:38269048-38269070 GCTCTGGGAAGTTGCAGCCAGGG + Intergenic
907523666 1:55040878-55040900 GCTGTGGGAAGCTTCTTCCCGGG + Intronic
909211414 1:72829742-72829764 GGTGTGTGCAGCCCCAGCCAGGG + Intergenic
910115290 1:83724902-83724924 GTTGAGAGAAACTCCAGCCATGG - Intergenic
915624048 1:157103750-157103772 GCTTGGGGAAGCTCTAACCATGG + Intergenic
919738256 1:200967060-200967082 GCTGTGCCAAGGGCCAGCCATGG - Intergenic
919918688 1:202155074-202155096 GCTATAGGAAGCTCCAGGCCAGG - Intronic
923031200 1:230250228-230250250 ACTGTGGGAACATCCAGGCAGGG + Intronic
923338079 1:232986787-232986809 AGTGTGAGAAGCTGCAGCCAGGG + Intronic
1063103289 10:2970236-2970258 GGTGTGGGAGGCACCAGGCACGG + Intergenic
1063421377 10:5915183-5915205 GCTGGGGCAGGCTCCAGCCGAGG - Intronic
1063463608 10:6229523-6229545 GCTGTGGGAAGCAGCTGCAAGGG - Intronic
1064214727 10:13390843-13390865 GCTGGGGAAAGTTCCAGCCCGGG - Intergenic
1064423943 10:15213703-15213725 GGTGTGGGAAGATCCCGGCATGG + Exonic
1064768578 10:18699800-18699822 GATTTGGGAATCTCTAGCCAGGG - Intergenic
1064900772 10:20293423-20293445 AATGTTGGAAGTTCCAGCCAAGG - Intergenic
1066076047 10:31878020-31878042 GCTGCAGTAAGCTCCAGCCTGGG + Intronic
1066250088 10:33624843-33624865 GCTTTAGGAAGCTCCACCCATGG + Intergenic
1066950711 10:42113051-42113073 GCTGCGGGTTTCTCCAGCCACGG - Intergenic
1067090803 10:43265049-43265071 GCGGTGGGAGGGGCCAGCCAGGG - Intronic
1067947995 10:50703037-50703059 GCTGTGAGAAGCCCAAGCCATGG + Intergenic
1069845260 10:71366583-71366605 GCTGGGGGAAACTTCAACCAGGG + Intergenic
1070056338 10:72938327-72938349 TGTGTTGGAAGCTCTAGCCAGGG + Intronic
1070883306 10:79868035-79868057 GCTGTGAGAAGCCCAAGCCATGG + Intergenic
1071450266 10:85786980-85787002 CCTGGGGCAAGCCCCAGCCATGG - Intronic
1071649874 10:87384342-87384364 GCTGTGAGAAGCCCAAGCCATGG + Intergenic
1072658058 10:97344552-97344574 GCTGGGGAGAGCTCCAGGCAGGG - Intergenic
1072926509 10:99621074-99621096 GCTGCGGGTCGCGCCAGCCAGGG - Intergenic
1072998920 10:100271013-100271035 GATGTGGCACGCACCAGCCACGG + Intergenic
1074345573 10:112682744-112682766 GCTTGGGAATGCTCCAGCCAGGG - Intronic
1074781067 10:116802754-116802776 CCTGTGGGAAGGCCCTGCCAGGG - Intergenic
1075464175 10:122639053-122639075 GCTGTGGGAAGCTCCAGCCATGG - Intronic
1075680230 10:124326119-124326141 GCTGTGGGAGGCTCCAGTTCTGG - Intergenic
1075818871 10:125288203-125288225 GATTTGGGAATCTCCAGCCTGGG + Intergenic
1076361726 10:129894448-129894470 CCTGTGGGATGTGCCAGCCACGG - Intronic
1076375029 10:129977897-129977919 CCTGTGGTCCGCTCCAGCCACGG - Intergenic
1076754019 10:132558650-132558672 GCTGGGGGACGCTCCAGGTAGGG + Intronic
1076775164 10:132691474-132691496 GCTGCAGGAAGCTGGAGCCAAGG + Intronic
1077032631 11:476456-476478 GCTGCCGGAAGCTCAACCCATGG + Intronic
1077834268 11:5910607-5910629 GCTGCAGCAAGCTCCACCCAAGG - Intronic
1077946802 11:6908694-6908716 AGTGTTGGAAGTTCCAGCCAGGG + Intergenic
1078531821 11:12142475-12142497 GTTGTGAGAACCTCCAGCAAAGG + Intronic
1078802932 11:14665397-14665419 ACTGTTGGAAGTTCTAGCCAGGG + Intronic
1079139370 11:17797802-17797824 GATGTGGAAAGCAGCAGCCATGG + Intronic
1081218886 11:40436264-40436286 GCTTTGGGAAGCCCCAGAGAGGG + Intronic
1082559038 11:54597308-54597330 ACTGTTGGAAGTTCCGGCCAAGG - Intergenic
1082783176 11:57302380-57302402 GCTCAGGGAAGCTCCAGGAATGG + Intronic
1083315951 11:61815253-61815275 ACTGCGGGAAGCTCCAGCGTTGG + Intronic
1083494423 11:63038329-63038351 GCTGTTGGAAGTTCTGGCCAGGG - Intergenic
1084147632 11:67273506-67273528 ACTGGGGGCAGCTCCTGCCAGGG - Intronic
1086925895 11:92640291-92640313 ACTGTGAGAACCACCAGCCAGGG + Intronic
1087750877 11:102005635-102005657 CCTGTGGGATGCTGCAGCCCAGG - Intergenic
1089213160 11:116819925-116819947 GCTGTGGGCAGCTGCAGCCTTGG - Intergenic
1089499092 11:118922384-118922406 GCTGGTGGGAGCTCCTGCCAGGG - Intronic
1090785400 11:130043798-130043820 GCCTTGGGCAGCTCCAGCCTGGG - Intergenic
1091339727 11:134800982-134801004 GCTGTCGGAAGCTGAAGCCCTGG + Intergenic
1091603597 12:1932479-1932501 GGGCTGGGAAGCTCCAGCCCTGG - Intergenic
1091674359 12:2478113-2478135 GCAGAGAGAAGCTCCACCCATGG + Intronic
1091874661 12:3924076-3924098 GGTGTGGCGAGCTCCAGCAAGGG + Intergenic
1091950855 12:4591804-4591826 TCTGGAGGAAGCTACAGCCAAGG - Intronic
1092309257 12:7334620-7334642 AGTGTTGGAAGTTCCAGCCAGGG + Intergenic
1095176296 12:39095895-39095917 GCTGTAGCAAGCCCCACCCAAGG + Intergenic
1096670019 12:53193060-53193082 GCTCTGGGAATCTCCTGGCATGG - Exonic
1097893411 12:64800723-64800745 GCTGTGGGAGGCTAGAGGCAGGG + Intronic
1102006336 12:109591315-109591337 GATGGGGGAAGCCCCAGCCCCGG + Exonic
1102213297 12:111142834-111142856 GCTGTGGGGAGCTGCAGCTGGGG + Intronic
1103346396 12:120253513-120253535 GTTGTGGGAAGACCCACCCAAGG + Intronic
1103971811 12:124677345-124677367 GCTGGGGGAAGCCCCAGCGTGGG - Intergenic
1107187959 13:37546566-37546588 GCAGTGGGAATGTTCAGCCAGGG + Intergenic
1109470504 13:62798864-62798886 GCTCTGTGGAGCTGCAGCCACGG - Intergenic
1114670489 14:24408351-24408373 GCAGAAGGAAGCCCCAGCCATGG + Exonic
1117194589 14:53327087-53327109 GCTGTGAGAAGCCCAAGCCATGG + Intergenic
1117207618 14:53460334-53460356 CCTGGGGGAAGCTCCCGCAAAGG + Intergenic
1118076719 14:62307678-62307700 ACTGTTGGAAGCTCTGGCCAGGG - Intergenic
1118385373 14:65251696-65251718 GCTCTGGGATGCTCCTGCCTGGG + Intergenic
1119466487 14:74862815-74862837 GATGTGGGAAGGTGCAGTCAAGG + Intronic
1120818115 14:88884260-88884282 GCTGTGTGTAGCTCCAGACTTGG - Intergenic
1121465672 14:94114042-94114064 GCTGTGAGTGGCTCCAGTCATGG + Intronic
1121818589 14:96947051-96947073 GCAGTGGGAAGAGCCTGCCAAGG + Intergenic
1122151921 14:99730291-99730313 GCAGTGGCAAGCTCTGGCCACGG + Intergenic
1122306990 14:100772710-100772732 TCTGTGGGAAGGGCCAGCAAAGG - Intergenic
1122740111 14:103867356-103867378 GCCCCGGGGAGCTCCAGCCAGGG - Intergenic
1122744255 14:103888669-103888691 GGTGAGGGAGGCTCCAGGCATGG - Intergenic
1122799784 14:104223751-104223773 GCCTTGGGGAGCTCCAGCCTCGG + Intergenic
1122900193 14:104779234-104779256 TCTGTGGGATGCTCCGGCCAAGG + Intronic
1124433987 15:29632808-29632830 GCAGAGGGAGGATCCAGCCACGG - Intergenic
1124679351 15:31716813-31716835 CCTCTGGGCAGCTTCAGCCAGGG - Intronic
1125602580 15:40923610-40923632 GCAGTGGGTATTTCCAGCCACGG - Intergenic
1125756136 15:42066254-42066276 GCTGTCAGAAGCTCCAGTCCTGG + Intergenic
1126060965 15:44782205-44782227 GCTGTGCAAACCTTCAGCCAGGG - Intergenic
1126556019 15:49988495-49988517 GCTGTGGGTAGATCCAATCAGGG + Intronic
1132344599 15:101100753-101100775 GCTGTGCCAAGGCCCAGCCACGG - Intergenic
1132684448 16:1156469-1156491 GCTCTGGAAAGCCTCAGCCATGG - Intronic
1133081179 16:3321525-3321547 GCTGTGGTGAGCCCCAGCCTGGG - Intergenic
1133118930 16:3594656-3594678 GCAGTGGGAAGCTCCCCGCATGG + Intronic
1133129185 16:3665711-3665733 GCTGTGTGAAGGTGCAGCCCAGG - Intronic
1133285631 16:4689331-4689353 GCAGTGGGGGGCTCCAGGCACGG + Exonic
1133755717 16:8761159-8761181 GGTGGGGGAAGCTCCTGGCAGGG - Intronic
1134532513 16:14995152-14995174 GGTGTGGGAAGTTCTGGCCAGGG - Intronic
1137034510 16:35558130-35558152 CCTGTGGGAAGGTCCAGGGATGG + Intergenic
1137253676 16:46758179-46758201 GCTTTGGGAAGATCTGGCCAGGG - Intronic
1137688360 16:50402502-50402524 GCAGTGGGGAGCCACAGCCAAGG - Intergenic
1138316223 16:56072577-56072599 GCTGTGGGGAGCCCCAAACATGG - Intergenic
1138342612 16:56300384-56300406 GCCGTGGTGAGCTGCAGCCAGGG - Intronic
1138366216 16:56479791-56479813 GCTGAAGGAAGATCCATCCAGGG - Intronic
1138387663 16:56647493-56647515 GTTTTGGGAAGCTCCATCCTTGG + Intronic
1138712258 16:58983018-58983040 GCTGTGGTGGGCTCCACCCATGG + Intergenic
1138799751 16:60013217-60013239 GCTGTGGGGATCTCAAGCCAGGG - Intergenic
1139960323 16:70713895-70713917 GCTGTGGGAAGCCCGAACCTGGG + Intronic
1139966956 16:70751063-70751085 GCTCTGAGCAGCTCCTGCCAAGG + Intronic
1141338606 16:83181377-83181399 GCTGTGGGTGGCTCTAGCCTAGG + Intronic
1141680139 16:85538917-85538939 GCTGTAGGCCACTCCAGCCAAGG - Intergenic
1142489895 17:271780-271802 ACTGTTGGAAGCTCTGGCCAGGG - Intronic
1143606050 17:7986865-7986887 GCTCTGAGAAGCCCAAGCCATGG + Intergenic
1143630960 17:8140184-8140206 GCTTGGGTAAGCTCCAGCCCGGG - Intergenic
1143836944 17:9700311-9700333 GCTGGGGGAAGCTGCGTCCAGGG - Intronic
1144312381 17:14025011-14025033 GCTGGAGGGAGCTCCAGCCAAGG + Intergenic
1144332371 17:14236314-14236336 GCTGGAGGGAGCTCCAGCCAAGG - Exonic
1144498460 17:15765202-15765224 GGTGGAGGGAGCTCCAGCCAAGG + Intergenic
1145037929 17:19554114-19554136 GCTGTGGGATGCCTCAGCAAAGG + Intronic
1145161842 17:20580243-20580265 GGTGGAGGGAGCTCCAGCCAAGG + Exonic
1145927926 17:28661812-28661834 GCTGTGGGAGCGTCCAGCCTGGG - Exonic
1147140156 17:38456090-38456112 GCTGAGTGGAGCTCCAGGCAAGG - Intronic
1150384342 17:64746212-64746234 GTTTTGGCAAGCTCCAGCAAGGG + Intergenic
1150771745 17:68048028-68048050 GTTTTGGCAAGCTCCAGCAAGGG - Intergenic
1152013462 17:77734936-77734958 GCTGAGAGAAGCTCCAGCTTGGG + Intergenic
1152266350 17:79297120-79297142 GCTCTGCCAAGCTCCAGACAAGG - Intronic
1154492284 18:14931602-14931624 GGTGTGGGAGGCTCCAGGAAGGG + Intergenic
1155396639 18:25393290-25393312 GTGGAGGGAATCTCCAGCCATGG + Intergenic
1157873977 18:51254594-51254616 GCTGTGGAAAGTTCCAGCGCTGG - Intergenic
1160005307 18:75064500-75064522 GGTGTGGGAAGGTCCAGCTTCGG + Exonic
1160089140 18:75809523-75809545 AGTGTGGGGAGCTCCATCCAGGG + Intergenic
1160131195 18:76226303-76226325 TGTGTGTGCAGCTCCAGCCAGGG - Intergenic
1160223828 18:76997315-76997337 GAGCTGGGAAGCTCCAGCCCGGG + Intronic
1160289711 18:77580044-77580066 GATGTAGGAAGCTCCACCAATGG + Intergenic
1160427426 18:78787829-78787851 GCTGAGGGCAGCACCAGGCATGG - Intergenic
1160539828 18:79614415-79614437 GCGGTGAGAACCTCCTGCCATGG - Intergenic
1160940340 19:1617850-1617872 GCTGAGGGGAGCTCCTGGCATGG - Intronic
1161591214 19:5129930-5129952 GCTGTGGGAAGCTCGTGCCGGGG - Intronic
1162110766 19:8398485-8398507 GCTGCAGGGAGCTCCAGCCAAGG - Intronic
1163376018 19:16931038-16931060 GCTATGGGATGCTGCAGCCAGGG + Intronic
1163880772 19:19919962-19919984 AGTGTTGGAAGTTCCAGCCAGGG - Intronic
1164557995 19:29268374-29268396 ACTGTGGGCAGCTCCAGGGAGGG + Intergenic
1165600376 19:37050726-37050748 GGTGTTGGAAGTTCTAGCCAGGG - Intronic
1166017007 19:39989288-39989310 ACTGTGGGATGCTCAAGTCAGGG - Intronic
1166664769 19:44672574-44672596 GCTGTGGGAAGTTACAGGGAAGG - Exonic
1166724294 19:45016608-45016630 GTTATGGGAAACTCCAGCCTGGG + Intronic
1167464861 19:49645369-49645391 GCTGTGGGAAGCTCCCTGCAGGG + Exonic
1167669446 19:50841366-50841388 GCTGGGGGATGCTCTAGCCTTGG + Intergenic
925884121 2:8379857-8379879 CCTGTGGGAATAACCAGCCAAGG - Intergenic
929533209 2:42764923-42764945 GCTGGGGCTAGCTCCAGACAAGG + Intergenic
929788342 2:45007451-45007473 CCTGTGGGAAGCTCCCTCCCAGG - Intronic
930493534 2:52108237-52108259 GCTGTGGGAAGTTCAAGTCTAGG - Intergenic
930581490 2:53217228-53217250 GCTGTGGCAGACTGCAGCCAGGG - Intergenic
931217664 2:60261641-60261663 AATGTGGGAAACTCCAGTCATGG + Intergenic
933086420 2:78059501-78059523 GCTGTGGCAAGCCCCACCCAAGG - Intergenic
935600349 2:104915987-104916009 GCTGTGTGCACCTCCAGCAAGGG + Intergenic
937919784 2:127120948-127120970 GCTGGGGGCAGCTCCAGGCAAGG + Intergenic
938235743 2:129705327-129705349 TGTGTGAGAAGCTCCAGCCGGGG + Intergenic
938599423 2:132821854-132821876 GCCGTGGCAAGCTCCACCCAAGG + Intronic
939704900 2:145440733-145440755 GGTGTTGGAAGCTCTGGCCAGGG + Intergenic
941784116 2:169479519-169479541 GCTGTGGAGAGATCCTGCCACGG + Exonic
942783500 2:179673267-179673289 TCTGTGGGAACTTCAAGCCATGG - Intronic
943583317 2:189709917-189709939 GCTGTAGGAAGCAGCAGCCCTGG - Intronic
946546455 2:220749458-220749480 GCTGTGGCAGGCTGCAGCCAGGG + Intergenic
948248071 2:236503341-236503363 GCTGTGGGCAGAACCATCCAGGG + Intronic
948757139 2:240166397-240166419 GCTGAGGAAAGCTCCAGGCAGGG + Intergenic
948785712 2:240351592-240351614 GCTCTTGGAAGCCCCTGCCACGG + Intergenic
948933018 2:241144430-241144452 CGTGGGGGAAACTCCAGCCATGG - Intronic
1170567016 20:17613240-17613262 GCAGTGGGCTGCTCCAGCCCTGG + Intergenic
1170816290 20:19717252-19717274 GCCGTGGGGCACTCCAGCCAGGG + Intronic
1171218923 20:23375875-23375897 GAAGTGGGAAGGGCCAGCCAAGG - Exonic
1171296752 20:24023797-24023819 GCTGAGGGCAGCTCCAGCCAAGG - Intergenic
1171330875 20:24337823-24337845 CCTGAGTGAAGCACCAGCCAGGG - Intergenic
1171513767 20:25710501-25710523 GGTGTTGGAAGTTCTAGCCAGGG - Intergenic
1172168387 20:32913223-32913245 GATGGGGGAAGTTCCAGACAAGG + Intronic
1172894699 20:38292323-38292345 CCTGTGGAAAGCACCAGCCCTGG + Intronic
1173168035 20:40699839-40699861 ACAGTGGGTAGCCCCAGCCAAGG + Intergenic
1173379988 20:42531562-42531584 ACTGTTGGAGGCTGCAGCCAAGG - Intronic
1173408532 20:42788721-42788743 GCTGCGGGATTCTCCAGCAATGG + Intronic
1173872079 20:46348459-46348481 GATGTGGGAAGAGCCAGCCAAGG - Intronic
1174039591 20:47689449-47689471 CCTGTGGCAAGACCCAGCCATGG + Intronic
1175153368 20:56953010-56953032 GCAGTGGGAAGCCCCAGGCTGGG - Intergenic
1175275179 20:57763585-57763607 GCTGTGTGAAGGTCCAGGGAAGG + Intergenic
1176087902 20:63306473-63306495 CCTTTGGGAACCTCCAGCCTGGG + Intronic
1176365012 21:6027552-6027574 GCACTGGGAAGTTTCAGCCAGGG - Intergenic
1176449628 21:6851120-6851142 GCTCTGGGAAGCTGCAGTGAAGG + Intergenic
1176827800 21:13716144-13716166 GCTCTGGGAAGCTGCAGTGAAGG + Intergenic
1178414046 21:32389480-32389502 ACTCTGGGCAACTCCAGCCACGG + Intronic
1179758506 21:43510993-43511015 GCACTGGGAAGTTTCAGCCAGGG + Intergenic
1181948742 22:26539224-26539246 GCCATGGGAAGGACCAGCCATGG + Intronic
1182130405 22:27846079-27846101 GCTCTGGGAAGAATCAGCCATGG + Intergenic
1183214954 22:36473597-36473619 GGTTTAGGAAGCTCCAGCCAGGG - Intronic
1184662401 22:45971439-45971461 GCTCTGAGAAGCTCCGGGCAGGG - Intronic
1185020146 22:48369795-48369817 GCAGACGGAAGCCCCAGCCAGGG - Intergenic
1185227515 22:49661322-49661344 GCTGGGGTAGGCTCCAGGCAGGG - Intergenic
950407785 3:12815517-12815539 GCTGGGAGAACATCCAGCCATGG + Intronic
953452133 3:43014232-43014254 GCTGTGTGAAGCCACAGGCAGGG + Intronic
953452188 3:43014552-43014574 GCTGTGGGAAGTTGCAGGAAGGG + Intronic
953452310 3:43015270-43015292 GCTGTGGGAAGCCACAGGAAGGG + Intronic
953537445 3:43786972-43786994 GCTGAGGGAAGCTTAAGTCATGG - Intergenic
954150929 3:48656653-48656675 GCTGGGGGAAGCACGGGCCAAGG - Intronic
954629690 3:52041106-52041128 GCTGAGGGAGGATCCAGACAGGG - Intergenic
956884242 3:73542928-73542950 GCTGTGGCAAACTCCAGTTATGG - Intronic
957674352 3:83347260-83347282 GCCTTGGGAAGCTCCACCCCTGG - Intergenic
961390833 3:126551474-126551496 CCTTTGGAAAGATCCAGCCACGG - Intronic
962456298 3:135568409-135568431 TTTCTAGGAAGCTCCAGCCAAGG - Intergenic
964635150 3:158850345-158850367 GATGTGGAAAGCATCAGCCATGG + Intergenic
965889937 3:173500063-173500085 GGTGTTGGAAGTTCTAGCCAGGG - Intronic
965983210 3:174718717-174718739 GCTTTGGGAAGATACAGCCCTGG - Intronic
969373474 4:6748412-6748434 GCTGTGGGTAGCTCCTGCGCTGG - Intergenic
969538333 4:7770267-7770289 CCAGAGGGAAGCTCGAGCCATGG + Intronic
969627651 4:8315906-8315928 GCCGGGGGCAACTCCAGCCAAGG + Intergenic
969666276 4:8559144-8559166 GCTGCGGGAAGCTACAGCCTGGG - Intronic
970005909 4:11410502-11410524 GCTGTGGGGAGCACAGGCCATGG + Intronic
975841176 4:78475624-78475646 GTTGGGGGAGGCTCCAGCAAGGG + Intronic
978186678 4:105864226-105864248 AGTGTTGGAAGTTCCAGCCAGGG + Intronic
981347319 4:143691280-143691302 GCTTTGGGAAGCTGAAGCCGTGG - Intronic
981649564 4:147040334-147040356 TCTGTGGGAAGATACAGCCCCGG - Intergenic
983939082 4:173522946-173522968 GCTGTTGGAGCCTCCAACCAGGG + Intergenic
985764149 5:1768092-1768114 GCTGTGGGCAGCTGCACCCGGGG - Intergenic
985986403 5:3520332-3520354 ACTGTGGGAAAACCCAGCCAGGG - Intergenic
986039080 5:3969458-3969480 GCTTTGGAAAGCTGTAGCCAGGG + Intergenic
986541127 5:8844822-8844844 GTTGTTGGAAGCTCTAACCAGGG + Intergenic
986617884 5:9638777-9638799 GCTGTGGCAAGCCCCACTCAAGG - Intronic
989279309 5:39622434-39622456 GCTGTGAGGAGGTACAGCCAGGG - Intergenic
990701015 5:58475113-58475135 GCCTTGGGCAGCTCCACCCATGG + Intergenic
991044103 5:62205012-62205034 GCTGGGGGATCCTGCAGCCAAGG + Intergenic
991414611 5:66379450-66379472 GCTGTGGCAGGCCCCACCCAAGG + Intergenic
991623001 5:68565666-68565688 GCTGCAGCAAGCTCCACCCAAGG + Intergenic
992478455 5:77126886-77126908 GCTATGGCAAGCTCCAGTCCAGG + Intergenic
992827232 5:80562511-80562533 GCTGTGGGACCCTTCAGCCGTGG - Intronic
993345527 5:86777920-86777942 CCTGGGGGAAGCGGCAGCCATGG - Intergenic
995571702 5:113488368-113488390 GCTGCGGGGAGCTCCAGCAGCGG - Exonic
995698960 5:114912359-114912381 GCTGCAGGAAGCCCCACCCAAGG + Intergenic
1001573240 5:172744524-172744546 GCTGTGATAAGATCCAGCAAAGG - Intergenic
1001820095 5:174703645-174703667 GCTCTGACAAGCACCAGCCAAGG + Intergenic
1002101172 5:176858394-176858416 GAGGTGGGAAGCTCCTGCCTCGG + Intronic
1002301871 5:178262001-178262023 GCTGGGTGAGGCACCAGCCAGGG - Intronic
1003267864 6:4582269-4582291 ACTGAGGGAAGCTCCTGCCCAGG + Intergenic
1007418827 6:41707294-41707316 CCTGTGGGCAGGCCCAGCCATGG - Intronic
1007719785 6:43878212-43878234 GGTGAGGGAGGCTCCAGCCTGGG - Intergenic
1008688948 6:53956318-53956340 GCGGTGGGCAGCTGCAGCCTGGG + Intronic
1010274863 6:73957586-73957608 GATGTGTGAAGAGCCAGCCAGGG - Intergenic
1010820326 6:80407866-80407888 AGTGTTGGAAGTTCCAGCCAGGG - Intergenic
1012129752 6:95475563-95475585 AATGTTGGAAGTTCCAGCCAGGG + Intergenic
1014809477 6:125869696-125869718 TCTGCAGGAAGCTTCAGCCAAGG - Intronic
1016001075 6:139041882-139041904 CCAGTGGGAAGTTCTAGCCAGGG + Intronic
1016008289 6:139111804-139111826 CCTGTGGAAATCTCCAGCAAAGG + Intergenic
1018041879 6:159931922-159931944 GCTGTGTGATGCTCGAGCTAAGG + Intergenic
1018474877 6:164130388-164130410 GTGGTAGGAAGCTCCTGCCATGG - Intergenic
1019133927 6:169896691-169896713 GGTGTGGGTAGCGTCAGCCAGGG - Intergenic
1019154547 6:170030268-170030290 GCTCTGGGAAGCTCCAGGAAGGG - Intergenic
1019642555 7:2112045-2112067 GCTGAGTGATGCTCCAGGCACGG - Intronic
1019921116 7:4163773-4163795 GCTGTGGGTGGGGCCAGCCAGGG + Intronic
1021586197 7:22211548-22211570 GCTGTGGGCAGCTCAAGTCAGGG - Intronic
1021754960 7:23842991-23843013 GCTGTGACAAGCCCCACCCAAGG - Intergenic
1022410550 7:30135718-30135740 GATGTGGGAAGCTCCGGACCTGG - Intronic
1023183963 7:37514325-37514347 GTTGTGTGAAGCCCCAGTCAAGG - Intergenic
1024096648 7:45987599-45987621 GCTGTGGGAAGTCCCTGCGACGG + Intergenic
1024917892 7:54524602-54524624 GCTGTAGCAAGCCCCACCCAAGG - Intergenic
1025256303 7:57385807-57385829 GGTGTGGGAAGCACCTGCCAGGG - Intergenic
1026463246 7:70632741-70632763 GCTGTGGGATGCTCCAAAAAAGG - Intronic
1028890660 7:95984914-95984936 GATGTCGGAATCTTCAGCCAGGG - Exonic
1029507946 7:100973808-100973830 GCTTTGGGAGGCCCCAGCCTGGG + Intronic
1031220427 7:118958264-118958286 GCTGTGGCAAGCTGCACCCAAGG - Intergenic
1031804541 7:126292504-126292526 ACAGTGGGCAGCTGCAGCCATGG - Intergenic
1032122544 7:129167696-129167718 GCACTGGGAAGATCGAGCCAGGG + Intronic
1033355715 7:140597802-140597824 GCTGTGGGAAGCACTGGGCAGGG + Intronic
1034019497 7:147626461-147626483 GCTATAGCAAGCCCCAGCCAAGG + Intronic
1034270605 7:149801950-149801972 GCTGTGGTATGTGCCAGCCAGGG + Intergenic
1035728297 8:1838322-1838344 GTTGGGAGATGCTCCAGCCATGG + Intronic
1036002934 8:4628755-4628777 GCTGTGGGAAGCTCCTCCAAGGG - Intronic
1036691897 8:10949453-10949475 GCCCTGGGGAGCTCCAGCCCTGG - Intronic
1037664581 8:20956827-20956849 CCTGGGGGAAGCGGCAGCCATGG + Intergenic
1038872949 8:31516145-31516167 AGTGTTGGAAGTTCCAGCCAAGG - Intergenic
1042607985 8:70565597-70565619 GCCGTGGGAAGCCCCTCCCAAGG + Intergenic
1042749650 8:72144395-72144417 GCTGTGGGCGGAGCCAGCCAGGG - Intergenic
1042836637 8:73085070-73085092 GCTGAAGGAGGCTCCAGCAAAGG + Intronic
1045443838 8:102239762-102239784 GCTGTGGGAAGCGCCGGGGACGG + Intergenic
1046448688 8:114359008-114359030 GCTCTGGCAAGCCCCACCCAAGG + Intergenic
1047331585 8:123893943-123893965 GCTGTGGGCAGCTCCATACCAGG - Intronic
1047591998 8:126336478-126336500 GCTGTGGCAAGCCCCACCCCAGG + Intergenic
1047925309 8:129677017-129677039 GCTGAGGGCAGCTCCATCCTTGG - Intergenic
1048173275 8:132129108-132129130 GCTGTGGGAAGCCCCTGCCTGGG + Exonic
1048888031 8:138924346-138924368 GCTGTGGGAGGTTCCAGCTCAGG - Intergenic
1049587855 8:143440276-143440298 GCAGTGGGGAGGTGCAGCCACGG + Exonic
1049621921 8:143602318-143602340 CCTGTGGGCAGTGCCAGCCATGG + Exonic
1049796227 8:144498426-144498448 GCTGTGGTAGCCTCCAGGCAGGG + Intronic
1050332650 9:4561224-4561246 GCTGTGGGAAGCTGCCTGCAGGG + Intronic
1051327878 9:15992573-15992595 GCTGTTGGAAGTTCTGGCCAGGG + Intronic
1052122872 9:24738937-24738959 CCGGTGGGCAGCTCCAGCCGTGG + Intergenic
1053056311 9:34994903-34994925 TCTGTGTGCAGCTCCAGCTAGGG + Intronic
1056561403 9:87733029-87733051 GCTGTGGGAAGCCCAAGCCATGG - Intergenic
1056575027 9:87849652-87849674 GCTATGAGAAGCCCAAGCCATGG - Intergenic
1056672447 9:88642039-88642061 GCTGTAGGAAACCCCAACCAAGG - Intergenic
1056790557 9:89622682-89622704 GCCGTGGCCAGCTTCAGCCAGGG + Intergenic
1056822533 9:89853738-89853760 GCCGTGGGATCCTCCAGCCATGG - Intergenic
1056942455 9:90967111-90967133 GCTGTGAGAAGCTGGAGGCATGG - Intergenic
1059596657 9:115727955-115727977 GCTATTGGAAGTTCTAGCCAGGG + Intergenic
1060479375 9:124009026-124009048 GGTGCGAGAAGCTGCAGCCAAGG - Intronic
1060543767 9:124448726-124448748 AGTGTGGGAAGGCCCAGCCAGGG + Intergenic
1061135396 9:128730586-128730608 GCTGTGGAAAGCCCCAGCCCAGG - Exonic
1061938509 9:133871785-133871807 GCTGTGGGAGGCTGAAGCCTGGG + Intronic
1062270814 9:135707540-135707562 CCTGTGAGAAGGACCAGCCAAGG + Intronic
1203519557 Un_GL000213v1:33397-33419 GCTCTGGGAAGCTGCAGTGAAGG - Intergenic
1186788651 X:12975740-12975762 GTGGTCGGAAGCTCCAGCCGCGG + Exonic
1187229458 X:17406881-17406903 GATGTGGGAGGATGCAGCCAGGG + Intronic
1187487714 X:19720318-19720340 GCTGGGGGAAAGTCAAGCCAGGG - Intronic
1190604160 X:52123279-52123301 TGTGTTGGAAGTTCCAGCCAGGG + Intergenic
1192008964 X:67247702-67247724 GCTGTGGTAAGCTCCACCCAAGG + Intergenic
1192034070 X:67545011-67545033 CCTGCGGGAAGCTCCAGAGAAGG - Exonic
1193004367 X:76599099-76599121 AGTGTTGGAAGTTCCAGCCAGGG - Intergenic
1193781905 X:85713146-85713168 AGTGTTGGAAGTTCCAGCCAGGG + Intergenic
1194262689 X:91716679-91716701 GCTATGGCAAGCCCCAACCAAGG + Intergenic
1197475347 X:126915944-126915966 CCTGTTGGAAGTTCTAGCCAGGG - Intergenic
1198070078 X:133139514-133139536 GCTTTGGGAATCTTCATCCAGGG + Intergenic
1201939058 Y:19439142-19439164 AGTGTTGGAAGTTCCAGCCAGGG + Intergenic