ID: 1075464177

View in Genome Browser
Species Human (GRCh38)
Location 10:122639066-122639088
Sequence TTCCCACAGCTCCACCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075464175_1075464177 -10 Left 1075464175 10:122639053-122639075 CCATGGCTGGAGCTTCCCACAGC 0: 1
1: 0
2: 3
3: 31
4: 289
Right 1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG No data
1075464174_1075464177 -6 Left 1075464174 10:122639049-122639071 CCATCCATGGCTGGAGCTTCCCA No data
Right 1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075464177 Original CRISPR TTCCCACAGCTCCACCAGGC TGG Intronic
No off target data available for this crispr