ID: 1075466252

View in Genome Browser
Species Human (GRCh38)
Location 10:122652863-122652885
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075466245_1075466252 27 Left 1075466245 10:122652813-122652835 CCAGGGCTAGAGTTGACTATGCA No data
Right 1075466252 10:122652863-122652885 TATGGTAGCTGACCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075466252 Original CRISPR TATGGTAGCTGACCTGTTCC TGG Intergenic
No off target data available for this crispr