ID: 1075467219

View in Genome Browser
Species Human (GRCh38)
Location 10:122660825-122660847
Sequence CTGGAGTCCTAGAGAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075467213_1075467219 7 Left 1075467213 10:122660795-122660817 CCCAGGAGAATGGGAGCCTCTTC No data
Right 1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG No data
1075467208_1075467219 26 Left 1075467208 10:122660776-122660798 CCTCTCCACAGAGCTGTGTCCCA No data
Right 1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG No data
1075467207_1075467219 29 Left 1075467207 10:122660773-122660795 CCACCTCTCCACAGAGCTGTGTC No data
Right 1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG No data
1075467214_1075467219 6 Left 1075467214 10:122660796-122660818 CCAGGAGAATGGGAGCCTCTTCT No data
Right 1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG No data
1075467216_1075467219 -9 Left 1075467216 10:122660811-122660833 CCTCTTCTAAACACCTGGAGTCC No data
Right 1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG No data
1075467210_1075467219 21 Left 1075467210 10:122660781-122660803 CCACAGAGCTGTGTCCCAGGAGA No data
Right 1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075467219 Original CRISPR CTGGAGTCCTAGAGAGCTGA GGG Intergenic
No off target data available for this crispr