ID: 1075469471

View in Genome Browser
Species Human (GRCh38)
Location 10:122677352-122677374
Sequence TTCCTGACTCTCTGCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075469467_1075469471 -1 Left 1075469467 10:122677330-122677352 CCTCCATAACAATAAAACCACTT No data
Right 1075469471 10:122677352-122677374 TTCCTGACTCTCTGCAGAGGAGG No data
1075469468_1075469471 -4 Left 1075469468 10:122677333-122677355 CCATAACAATAAAACCACTTTCC No data
Right 1075469471 10:122677352-122677374 TTCCTGACTCTCTGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075469471 Original CRISPR TTCCTGACTCTCTGCAGAGG AGG Intergenic
No off target data available for this crispr