ID: 1075474371

View in Genome Browser
Species Human (GRCh38)
Location 10:122720830-122720852
Sequence GGGTGCAAACACATGTAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075474367_1075474371 4 Left 1075474367 10:122720803-122720825 CCAAGTGGACGTCGTAGAATTAG No data
Right 1075474371 10:122720830-122720852 GGGTGCAAACACATGTAGTTGGG No data
1075474366_1075474371 9 Left 1075474366 10:122720798-122720820 CCGTGCCAAGTGGACGTCGTAGA No data
Right 1075474371 10:122720830-122720852 GGGTGCAAACACATGTAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075474371 Original CRISPR GGGTGCAAACACATGTAGTT GGG Intergenic
No off target data available for this crispr