ID: 1075475330

View in Genome Browser
Species Human (GRCh38)
Location 10:122729163-122729185
Sequence AAGGTCATGCTGTTAGTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075475330_1075475339 28 Left 1075475330 10:122729163-122729185 CCCCTAACTAACAGCATGACCTT No data
Right 1075475339 10:122729214-122729236 TATCTCCTCCCTGGTAACATGGG No data
1075475330_1075475338 27 Left 1075475330 10:122729163-122729185 CCCCTAACTAACAGCATGACCTT No data
Right 1075475338 10:122729213-122729235 CTATCTCCTCCCTGGTAACATGG No data
1075475330_1075475336 19 Left 1075475330 10:122729163-122729185 CCCCTAACTAACAGCATGACCTT No data
Right 1075475336 10:122729205-122729227 TCAGTATCCTATCTCCTCCCTGG No data
1075475330_1075475340 29 Left 1075475330 10:122729163-122729185 CCCCTAACTAACAGCATGACCTT No data
Right 1075475340 10:122729215-122729237 ATCTCCTCCCTGGTAACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075475330 Original CRISPR AAGGTCATGCTGTTAGTTAG GGG (reversed) Intergenic
No off target data available for this crispr