ID: 1075479126

View in Genome Browser
Species Human (GRCh38)
Location 10:122764335-122764357
Sequence CAGCAGCCTCACCTCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075479126_1075479133 24 Left 1075479126 10:122764335-122764357 CCTGGAGGGAGGTGAGGCTGCTG No data
Right 1075479133 10:122764382-122764404 CTTGTGGAGGCTCTCATTTAGGG No data
1075479126_1075479130 11 Left 1075479126 10:122764335-122764357 CCTGGAGGGAGGTGAGGCTGCTG No data
Right 1075479130 10:122764369-122764391 GAGATGCTCAAGCCTTGTGGAGG No data
1075479126_1075479129 8 Left 1075479126 10:122764335-122764357 CCTGGAGGGAGGTGAGGCTGCTG No data
Right 1075479129 10:122764366-122764388 GAGGAGATGCTCAAGCCTTGTGG No data
1075479126_1075479132 23 Left 1075479126 10:122764335-122764357 CCTGGAGGGAGGTGAGGCTGCTG No data
Right 1075479132 10:122764381-122764403 CCTTGTGGAGGCTCTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075479126 Original CRISPR CAGCAGCCTCACCTCCCTCC AGG (reversed) Intergenic
No off target data available for this crispr