ID: 1075479132

View in Genome Browser
Species Human (GRCh38)
Location 10:122764381-122764403
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075479126_1075479132 23 Left 1075479126 10:122764335-122764357 CCTGGAGGGAGGTGAGGCTGCTG No data
Right 1075479132 10:122764381-122764403 CCTTGTGGAGGCTCTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075479132 Original CRISPR CCTTGTGGAGGCTCTCATTT AGG Intergenic
No off target data available for this crispr