ID: 1075481995

View in Genome Browser
Species Human (GRCh38)
Location 10:122789851-122789873
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075481995_1075481999 10 Left 1075481995 10:122789851-122789873 CCATGGCACATTTGCCAGGACAC No data
Right 1075481999 10:122789884-122789906 TCTCTTGCCCATTCCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075481995 Original CRISPR GTGTCCTGGCAAATGTGCCA TGG (reversed) Intergenic
No off target data available for this crispr