ID: 1075482278

View in Genome Browser
Species Human (GRCh38)
Location 10:122792137-122792159
Sequence GTGTAGACACAGTTGTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075482278_1075482284 24 Left 1075482278 10:122792137-122792159 CCAAACCACAACTGTGTCTACAC No data
Right 1075482284 10:122792184-122792206 GACTCCACTGCTGAGCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075482278 Original CRISPR GTGTAGACACAGTTGTGGTT TGG (reversed) Intergenic
No off target data available for this crispr