ID: 1075483414

View in Genome Browser
Species Human (GRCh38)
Location 10:122800469-122800491
Sequence GCTGCTGCTGGGACCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075483414_1075483422 20 Left 1075483414 10:122800469-122800491 CCCACCTGGGTCCCAGCAGCAGC No data
Right 1075483422 10:122800512-122800534 ACAAGGCACCCCTGTCTATGGGG No data
1075483414_1075483421 19 Left 1075483414 10:122800469-122800491 CCCACCTGGGTCCCAGCAGCAGC No data
Right 1075483421 10:122800511-122800533 GACAAGGCACCCCTGTCTATGGG No data
1075483414_1075483419 3 Left 1075483414 10:122800469-122800491 CCCACCTGGGTCCCAGCAGCAGC No data
Right 1075483419 10:122800495-122800517 TGAACTCTGTGATTCTGACAAGG No data
1075483414_1075483420 18 Left 1075483414 10:122800469-122800491 CCCACCTGGGTCCCAGCAGCAGC No data
Right 1075483420 10:122800510-122800532 TGACAAGGCACCCCTGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075483414 Original CRISPR GCTGCTGCTGGGACCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr