ID: 1075483894

View in Genome Browser
Species Human (GRCh38)
Location 10:122804871-122804893
Sequence TGCTGCCGCCTGCTGAGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075483892_1075483894 -5 Left 1075483892 10:122804853-122804875 CCTCCTTAGGGATGTGTGTGCTG No data
Right 1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG No data
1075483893_1075483894 -8 Left 1075483893 10:122804856-122804878 CCTTAGGGATGTGTGTGCTGCCG No data
Right 1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075483894 Original CRISPR TGCTGCCGCCTGCTGAGTTC CGG Intergenic
No off target data available for this crispr