ID: 1075485900

View in Genome Browser
Species Human (GRCh38)
Location 10:122821945-122821967
Sequence TGGCCCAGAGGCTTCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075485900_1075485908 13 Left 1075485900 10:122821945-122821967 CCCTCAGGGAAGCCTCTGGGCCA No data
Right 1075485908 10:122821981-122822003 TGCAAATGTTCTCTTTCGCCTGG No data
1075485900_1075485909 17 Left 1075485900 10:122821945-122821967 CCCTCAGGGAAGCCTCTGGGCCA No data
Right 1075485909 10:122821985-122822007 AATGTTCTCTTTCGCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075485900 Original CRISPR TGGCCCAGAGGCTTCCCTGA GGG (reversed) Intergenic