ID: 1075485904

View in Genome Browser
Species Human (GRCh38)
Location 10:122821957-122821979
Sequence GGTCTTCCCTGATGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075485904_1075485908 1 Left 1075485904 10:122821957-122821979 CCTCTGGGCCATCAGGGAAGACC No data
Right 1075485908 10:122821981-122822003 TGCAAATGTTCTCTTTCGCCTGG No data
1075485904_1075485909 5 Left 1075485904 10:122821957-122821979 CCTCTGGGCCATCAGGGAAGACC No data
Right 1075485909 10:122821985-122822007 AATGTTCTCTTTCGCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075485904 Original CRISPR GGTCTTCCCTGATGGCCCAG AGG (reversed) Intergenic