ID: 1075485909

View in Genome Browser
Species Human (GRCh38)
Location 10:122821985-122822007
Sequence AATGTTCTCTTTCGCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075485904_1075485909 5 Left 1075485904 10:122821957-122821979 CCTCTGGGCCATCAGGGAAGACC No data
Right 1075485909 10:122821985-122822007 AATGTTCTCTTTCGCCTGGCTGG No data
1075485901_1075485909 16 Left 1075485901 10:122821946-122821968 CCTCAGGGAAGCCTCTGGGCCAT No data
Right 1075485909 10:122821985-122822007 AATGTTCTCTTTCGCCTGGCTGG No data
1075485900_1075485909 17 Left 1075485900 10:122821945-122821967 CCCTCAGGGAAGCCTCTGGGCCA No data
Right 1075485909 10:122821985-122822007 AATGTTCTCTTTCGCCTGGCTGG No data
1075485905_1075485909 -3 Left 1075485905 10:122821965-122821987 CCATCAGGGAAGACCCTGCAAAT No data
Right 1075485909 10:122821985-122822007 AATGTTCTCTTTCGCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075485909 Original CRISPR AATGTTCTCTTTCGCCTGGC TGG Intergenic