ID: 1075487057

View in Genome Browser
Species Human (GRCh38)
Location 10:122831102-122831124
Sequence TGAACATGCATTGCATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075487057_1075487065 23 Left 1075487057 10:122831102-122831124 CCTGTAGATGCAATGCATGTTCA No data
Right 1075487065 10:122831148-122831170 TTGGGAATGTGGTTACCTGTTGG No data
1075487057_1075487062 5 Left 1075487057 10:122831102-122831124 CCTGTAGATGCAATGCATGTTCA No data
Right 1075487062 10:122831130-122831152 AAAAATGCCTTTGGGCATTTGGG No data
1075487057_1075487059 -4 Left 1075487057 10:122831102-122831124 CCTGTAGATGCAATGCATGTTCA No data
Right 1075487059 10:122831121-122831143 TTCAGAAGGAAAAATGCCTTTGG No data
1075487057_1075487064 12 Left 1075487057 10:122831102-122831124 CCTGTAGATGCAATGCATGTTCA No data
Right 1075487064 10:122831137-122831159 CCTTTGGGCATTTGGGAATGTGG No data
1075487057_1075487061 4 Left 1075487057 10:122831102-122831124 CCTGTAGATGCAATGCATGTTCA No data
Right 1075487061 10:122831129-122831151 GAAAAATGCCTTTGGGCATTTGG No data
1075487057_1075487066 24 Left 1075487057 10:122831102-122831124 CCTGTAGATGCAATGCATGTTCA No data
Right 1075487066 10:122831149-122831171 TGGGAATGTGGTTACCTGTTGGG No data
1075487057_1075487060 -3 Left 1075487057 10:122831102-122831124 CCTGTAGATGCAATGCATGTTCA No data
Right 1075487060 10:122831122-122831144 TCAGAAGGAAAAATGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075487057 Original CRISPR TGAACATGCATTGCATCTAC AGG (reversed) Intergenic
No off target data available for this crispr