ID: 1075487100

View in Genome Browser
Species Human (GRCh38)
Location 10:122831535-122831557
Sequence CATGTGAATCAAGGAGACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075487095_1075487100 29 Left 1075487095 10:122831483-122831505 CCTGAAATGCTTACAGTGAGAAA No data
Right 1075487100 10:122831535-122831557 CATGTGAATCAAGGAGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075487100 Original CRISPR CATGTGAATCAAGGAGACTG CGG Intergenic
No off target data available for this crispr