ID: 1075487634

View in Genome Browser
Species Human (GRCh38)
Location 10:122838589-122838611
Sequence GATCTAAGGAATCAGAGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075487628_1075487634 20 Left 1075487628 10:122838546-122838568 CCGGGGGACTTGTTAAACAGGAA 0: 1
1: 0
2: 1
3: 34
4: 268
Right 1075487634 10:122838589-122838611 GATCTAAGGAATCAGAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075487634 Original CRISPR GATCTAAGGAATCAGAGCAT AGG Intronic
No off target data available for this crispr