ID: 1075491424

View in Genome Browser
Species Human (GRCh38)
Location 10:122873764-122873786
Sequence GAGCAGTGCTTACAGGGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075491424 Original CRISPR GAGCAGTGCTTACAGGGAAA CGG (reversed) Intronic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
900950310 1:5854883-5854905 GAGCAGAGCTGACACCGAAAAGG + Intergenic
902886327 1:19407518-19407540 GAGCAGTGCTGATAAGGAAGAGG + Intronic
903304395 1:22402476-22402498 GGGCAGGGCTTGCAGGGGAATGG - Intergenic
903488508 1:23709482-23709504 GAGCAGTGCTGCCAGGGTGATGG + Intergenic
905940962 1:41862989-41863011 GAGCAATGCTTAAGGTGAAATGG + Intronic
906269184 1:44460940-44460962 GAGATGTGCTGACAGGGAAGGGG - Intronic
907153387 1:52309564-52309586 GAGCATAGCTCATAGGGAAATGG + Intronic
907410874 1:54282463-54282485 CAGCAGTGTTTAAAGAGAAAAGG - Intronic
907595806 1:55718808-55718830 GAGCAGTGCAAACAGGGGAAAGG + Intergenic
907655693 1:56340075-56340097 GGGGACTTCTTACAGGGAAATGG + Intergenic
908563617 1:65331814-65331836 GAGCACTGCTGACAGCAAAATGG - Intronic
910529991 1:88225101-88225123 AAGCAGTGCTCTCGGGGAAACGG - Intergenic
910757446 1:90707758-90707780 GAGGTGTGCTTTCAGAGAAAGGG - Intergenic
914218153 1:145653121-145653143 AAGCAGTGTTAAGAGGGAAATGG - Intronic
914224252 1:145707304-145707326 GAGCAGTTCTTACCTGGAGATGG + Exonic
914470713 1:147975802-147975824 AAGCAGTGTTAAGAGGGAAATGG - Intronic
915494791 1:156274389-156274411 GATCAGTGAATACAGGAAAAAGG - Intronic
917130100 1:171732669-171732691 CAGCAGTACTTAAAGGAAAATGG + Intronic
919370946 1:196724978-196725000 TAGCATTCTTTACAGGGAAAAGG + Intronic
920461536 1:206144344-206144366 GTGCAGGGCTGCCAGGGAAACGG + Intergenic
921482469 1:215678943-215678965 GAGAAGTGCTTTGAGGGAAAAGG + Intronic
921665134 1:217860044-217860066 AAGCAGTGCCTAGAGGAAAATGG - Intronic
921849428 1:219918960-219918982 GGTAAATGCTTACAGGGAAAGGG - Intronic
921887661 1:220322665-220322687 GAGCAGTCCTTCCAGGAAGAGGG - Intergenic
922741192 1:228015263-228015285 GAGCTGGGATTCCAGGGAAAGGG + Intronic
922877990 1:228955970-228955992 GAGCAGTGCTGAGTGGGCAAGGG + Intergenic
923120633 1:230986840-230986862 GAGAAGTGCTAAGATGGAAAAGG - Intronic
923341932 1:233015073-233015095 GGGCAGTGATTACAGTCAAATGG + Intronic
1063696697 10:8342684-8342706 GATCAGCAATTACAGGGAAAGGG + Intergenic
1063714157 10:8510805-8510827 GAACAGTGCCTACCTGGAAAAGG - Intergenic
1064491400 10:15860719-15860741 GAGCAGTGCGTAGAGGAAGAAGG - Intergenic
1066351648 10:34642083-34642105 GGGCCGTGCTTACAGGGCGAGGG - Intronic
1068939332 10:62665272-62665294 GAGAAGTGCTTATAGGAAATAGG - Intronic
1071404346 10:85315734-85315756 GACAAGCGGTTACAGGGAAACGG + Intergenic
1071799604 10:89043832-89043854 GAGGCCTGCTTACAGGGAGAGGG - Intergenic
1074040622 10:109784777-109784799 GATCAGTGCTTATAGGGTCAGGG + Intergenic
1075405092 10:122189677-122189699 GAGCATTGCTTAAGGGGAAGAGG - Intronic
1075491424 10:122873764-122873786 GAGCAGTGCTTACAGGGAAACGG - Intronic
1076076337 10:127536944-127536966 GAGCACTGCCTCCAGGGAAGGGG + Intergenic
1076165308 10:128277578-128277600 GAGCAGGACTCACACGGAAATGG + Intergenic
1077370178 11:2178058-2178080 GAGGGGTGCTTCCAGGGAAGGGG + Intergenic
1078055659 11:8006972-8006994 GAGCTTTCCTTCCAGGGAAAGGG + Intergenic
1078248746 11:9599957-9599979 GACCAGAGCATACAGGGAAATGG + Intergenic
1083694659 11:64434617-64434639 GAGCTCTGGTTACAAGGAAAGGG + Intergenic
1083740664 11:64709778-64709800 GAGCAGTGCTTTGTGGTAAAGGG - Intronic
1083902863 11:65652167-65652189 GGCCAGGGCTGACAGGGAAAAGG + Intergenic
1083908787 11:65692831-65692853 GAACACTCCTTACAGGGAACTGG - Intergenic
1084086098 11:66856185-66856207 GAGCCGCTCTTCCAGGGAAATGG + Intronic
1085159115 11:74324835-74324857 GAGAAGTACTTAAAAGGAAAGGG + Intergenic
1085339481 11:75721968-75721990 GAGCAGGGCCTCCAGGGCAAAGG + Intronic
1086136690 11:83448940-83448962 GAGCAGTGATTACTAGGAAAGGG - Intergenic
1086323407 11:85673245-85673267 GAGCAGTGATAGCAGGGAATGGG + Intronic
1090159669 11:124479474-124479496 GAGTAGTAATTACTGGGAAAGGG + Intergenic
1091066154 11:132515074-132515096 GAGCAGAGCTTGTTGGGAAAAGG + Intronic
1091744739 12:2983904-2983926 GACCAGTCCTTACTGGGAGATGG + Intronic
1093343678 12:18012779-18012801 GGACAATGCTTACTGGGAAATGG - Intergenic
1094276031 12:28676128-28676150 AAGCAGTGTGTAGAGGGAAAAGG - Intergenic
1094488586 12:30944575-30944597 GAACAGTGCTGACATGGACATGG - Intronic
1096395792 12:51265683-51265705 GAACGGTGTTTGCAGGGAAATGG + Intronic
1096443667 12:51668615-51668637 GAGCAGTGCTTCTGGGGGAAAGG + Intronic
1096668123 12:53180683-53180705 GGGAAGTGCTTCCGGGGAAACGG + Exonic
1096882640 12:54685318-54685340 GGGCAGTGGTTGCAGGGACATGG - Intergenic
1097925258 12:65120742-65120764 GACCCATGCTTTCAGGGAAAAGG + Intronic
1100097609 12:91061619-91061641 GAGCAGGGCTTACACTGAAATGG - Intergenic
1101877323 12:108604385-108604407 GTGAAGTGCTGTCAGGGAAATGG + Intergenic
1103379692 12:120484293-120484315 GAACAGTTCATACAGGGTAACGG + Intronic
1103797010 12:123510160-123510182 GAGCAGAGCTGACGGGGAGAGGG - Intronic
1103967767 12:124651113-124651135 CAGCTGTGTTCACAGGGAAACGG + Intergenic
1104649090 12:130518238-130518260 GAGCAGTGTTCACGGGAAAAAGG - Intronic
1105063532 12:133176266-133176288 AAGCAGTGCTAAGAGGGAAGTGG + Intronic
1105801173 13:23904017-23904039 GCCCCCTGCTTACAGGGAAAAGG + Intergenic
1106318514 13:28616781-28616803 TAGCAGAGATTACAGAGAAAAGG - Intergenic
1106627750 13:31438212-31438234 GAACAGTGCTTACAAGCAAAAGG - Intergenic
1110045050 13:70817609-70817631 CAGAATTGCATACAGGGAAATGG - Intergenic
1110300045 13:73915463-73915485 GAGCAGCGACTGCAGGGAAAGGG - Intronic
1110757528 13:79193073-79193095 TAGCAGTGCTAACAGGGACAAGG + Intergenic
1117542554 14:56762315-56762337 GAGCAGAGGACACAGGGAAAAGG - Intergenic
1117691572 14:58312946-58312968 GTGCTGTGATAACAGGGAAATGG + Intronic
1118281942 14:64437567-64437589 GAGCAGATCCTACAGGTAAAGGG + Intronic
1119851177 14:77867693-77867715 GGGCAGTGGTCACAGGGAGAAGG - Intronic
1120461242 14:84799024-84799046 GAGCAGGGATTACAGTGAAGGGG + Intergenic
1120938726 14:89924500-89924522 TAGCAGTGCTTACAATGAGATGG + Intronic
1121271777 14:92642399-92642421 GAGAATTTCTTACAGGGAAAGGG + Intronic
1122468519 14:101950335-101950357 CAGCAGTGCAGAGAGGGAAAAGG + Intergenic
1124229849 15:27935000-27935022 GAGCATTGCTCACAGGGACCGGG - Intronic
1125738362 15:41944020-41944042 GGGCAGTGACTACAGGGAAAGGG - Intronic
1126547927 15:49893028-49893050 CAGCAGTGCCCACAGGGAACTGG + Intronic
1128328576 15:66741199-66741221 GAGAGCTGCTTACAGGGCAAAGG - Intronic
1130732355 15:86510083-86510105 CAGCATTGCTTTCAGGGAATGGG + Intronic
1131574645 15:93574901-93574923 AAGCTGTGCTTACAGGAAAATGG - Intergenic
1131831252 15:96355878-96355900 GAGCCCTGGTTACAGGGAGAAGG + Intergenic
1132892179 16:2209847-2209869 GAGCTGTGGTTTCAGGGAACAGG - Intronic
1133574007 16:7069896-7069918 CAGCTCTGCTTTCAGGGAAACGG + Intronic
1133888503 16:9854827-9854849 CAGCAGTGCTTCCAGGAATAAGG + Intronic
1133937687 16:10282375-10282397 GGGCAGTTCTTACATGGAAGTGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1135126247 16:19811890-19811912 AATCAGTACCTACAGGGAAAGGG + Intronic
1139229339 16:65268046-65268068 GAGCAGTGATTACAGGTGATTGG + Intergenic
1139905979 16:70366394-70366416 GATCAGCGCTGACATGGAAATGG - Intronic
1140271793 16:73472779-73472801 GAGCTGTGACCACAGGGAAAGGG - Intergenic
1141322953 16:83028917-83028939 GTGCAGTGGTGACAGGCAAATGG + Intronic
1141483076 16:84319617-84319639 GAGAGGCGCTTACAGGGAGAAGG - Intronic
1142503674 17:349117-349139 GTGCAGGGCTCAGAGGGAAAAGG + Intronic
1143410339 17:6704703-6704725 GAGCAGGGGTTACAAGCAAAGGG - Intronic
1143782989 17:9239269-9239291 GAGCAGTGCTGGCGGGGAGAGGG - Intronic
1144474289 17:15571941-15571963 GATCAGTGGTTACTGGGAAACGG + Exonic
1144626842 17:16848191-16848213 CAGCAGTGCTTACAGGGGCCTGG - Intergenic
1146064719 17:29625148-29625170 GAGCAGTGCTTTCTGGGTACAGG + Intergenic
1147864177 17:43542135-43542157 GAGCAGTGATTCCTGTGAAAAGG + Intronic
1148163754 17:45468098-45468120 GAGGAAGGCTAACAGGGAAAAGG + Intronic
1148438083 17:47697492-47697514 GGGCAGTGCTCACAGGCACAGGG - Intronic
1148438092 17:47697535-47697557 GGGCAGTGCTCACAGGCACAGGG - Intronic
1151036697 17:70808872-70808894 GAGCAGTGATTAGAAGGACAGGG + Intergenic
1151978319 17:77494838-77494860 GAGGAGTGCAGACAGGGGAAAGG - Intronic
1153180903 18:2432065-2432087 GAGCAGTGGTTACTGGGATCTGG + Intergenic
1153912338 18:9715229-9715251 GAACAGTGCCTAAAGGGACAGGG + Intronic
1157124013 18:44938024-44938046 GATCTGTGCTGACAGGGAAAGGG + Intronic
1157377008 18:47176251-47176273 CAGCAGTGAGTACAGGGTAAAGG + Exonic
1157904475 18:51557075-51557097 GAGCAGTCCCAACAGAGAAAGGG - Intergenic
1158343659 18:56492599-56492621 GAGCAGTATTGACTGGGAAAGGG - Intergenic
1163491452 19:17619276-17619298 GGGCAGGGTTTCCAGGGAAAGGG + Intronic
1166870148 19:45865787-45865809 GGGCAGGGCCAACAGGGAAAGGG + Intronic
925639035 2:5969653-5969675 GAGCAGTATTTACAGTGAAAAGG - Intergenic
926400745 2:12493442-12493464 GAGCTGTCCCTACAGGGAGAAGG - Intergenic
928131780 2:28656896-28656918 CTGCTGTTCTTACAGGGAAATGG + Intergenic
930218910 2:48725935-48725957 GAGCAGTGCTTCCTGGAAATAGG - Intronic
931912131 2:66911527-66911549 AAGCAGTGTGTAGAGGGAAATGG - Intergenic
935591075 2:104845643-104845665 GGGCAGTGCTCAGAGAGAAAAGG + Intergenic
936686251 2:114829969-114829991 CAGCAGAGCTTAGAGGAAAATGG - Intronic
937766529 2:125667272-125667294 GAGCAGTGGTTACAGGGTTGTGG + Intergenic
938760243 2:134418720-134418742 GAGCTGTGCTTTCAAGGAAAAGG + Intronic
940405723 2:153299701-153299723 GAGCAGAGCTTGGTGGGAAAAGG + Intergenic
941605647 2:167593488-167593510 TAACAGTGGTTACAGGGAATGGG + Intergenic
942944604 2:181658631-181658653 CAGCAGTCATTAGAGGGAAAAGG + Intronic
944836597 2:203586256-203586278 CAGAAGTGATTCCAGGGAAAGGG - Intergenic
945359032 2:208873448-208873470 AAGCAGTGACTGCAGGGAAAGGG + Intergenic
945775315 2:214100135-214100157 GAGAAGTGCAAGCAGGGAAAAGG - Intronic
948015916 2:234690427-234690449 TAGCAGTGTCTGCAGGGAAAGGG + Intergenic
1170431205 20:16278574-16278596 GAGCAGGGGTTACAGGTAACTGG + Intronic
1170871638 20:20211818-20211840 GAGCTGTGCTTCCAGGGAACAGG + Intronic
1170910153 20:20558269-20558291 GTGCTGGGATTACAGGGAAAAGG + Intronic
1172115191 20:32569539-32569561 GAGCACTACTTCCTGGGAAAGGG + Intronic
1173374608 20:42472233-42472255 GAGGAGAGCTTACATGGGAATGG - Intronic
1174380551 20:50153116-50153138 GGGCAGTGCTTACAGCTGAAGGG + Intronic
1174682023 20:52417700-52417722 GATAAGTGTTTTCAGGGAAAAGG - Intergenic
1174878672 20:54252938-54252960 GAGCAGAGCTGACTAGGAAAAGG - Intergenic
1174942955 20:54952016-54952038 GAACACAGCTTACAGGCAAAGGG - Intergenic
1177621709 21:23603920-23603942 TAGCAGTGCTTACAGACAGATGG + Intergenic
1177724420 21:24948677-24948699 GAACAGGGATTACAGGTAAAGGG + Intergenic
1177887593 21:26764647-26764669 GGGCACTGGTTACAGGTAAATGG + Intergenic
1178491718 21:33056808-33056830 AAGCAAAGCTTATAGGGAAAAGG + Intergenic
1180312816 22:11253312-11253334 CAGCAGTGCGTGCAGGGAAGAGG - Intergenic
1181891422 22:26066928-26066950 GAGCAGTCCTTGAAGGGGAAGGG + Intergenic
1182575497 22:31270268-31270290 GAGCAGGGCTGACACTGAAAAGG + Intronic
1184674554 22:46033894-46033916 AAGCAGTGCTTACTGGGCACTGG - Intergenic
1185308623 22:50139351-50139373 GAGCATGACTTACAGAGAAATGG + Intronic
950684446 3:14606408-14606430 GAGCAGTGGACAAAGGGAAAAGG + Intergenic
950965000 3:17140005-17140027 AGGCAGTGCAAACAGGGAAAGGG - Intergenic
951486496 3:23217875-23217897 GAAAAGTGCTTACCTGGAAATGG + Intronic
952002434 3:28801989-28802011 GAGGAGTGCTTTGAGAGAAATGG + Intergenic
952447709 3:33398694-33398716 GATCACTGCTCACAGCGAAAGGG + Intronic
952817015 3:37454318-37454340 GAGCAGATCTGACAGAGAAAAGG + Intronic
953212379 3:40887510-40887532 CAGCACTGTTTACATGGAAAGGG - Intergenic
954097215 3:48338256-48338278 GAGGACTTCTTCCAGGGAAAAGG + Intergenic
954289393 3:49641804-49641826 GAGCAGTGCTTATATGCAATGGG - Intronic
956734034 3:72222912-72222934 GAGGAGTGCATGCAGGGAAGGGG - Intergenic
957573202 3:81975512-81975534 GAGCCATGCTTTCAAGGAAAAGG + Intergenic
958859325 3:99426608-99426630 GAGCAGTTGTTAAAGGGAACAGG - Intergenic
959932752 3:112000997-112001019 GAGCAGTTTTTACAAGGAGATGG - Intronic
960245401 3:115394671-115394693 GAGCAGAGTTTACAGGCAAAAGG - Intergenic
960634676 3:119771922-119771944 AAGCAGTGCTTACAGAGAAATGG + Intergenic
961949084 3:130727728-130727750 GATCAGTACATTCAGGGAAAAGG + Intronic
962393605 3:134994330-134994352 AAGCAGTGCAGACAGGGAGAGGG - Intronic
963090260 3:141477237-141477259 CAGCATAGCTTGCAGGGAAAGGG + Intergenic
964359261 3:155877536-155877558 GAGCGGTGGTTGCAGGAAAATGG - Intronic
964697943 3:159530797-159530819 GGGCAGTGCCTACAGGGGACAGG - Intronic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
966264570 3:178023577-178023599 GATCAGTGGTAACAGGGAAAGGG + Intergenic
966759112 3:183400528-183400550 GTGCAGTGCCTAGAGAGAAATGG - Intronic
969443673 4:7232340-7232362 GAGCAGAGCCCACAGGGAACAGG - Intronic
969571865 4:8013782-8013804 GAGAGATGCTTCCAGGGAAAGGG + Intronic
972116368 4:35639889-35639911 GAGCATTGGTAAGAGGGAAAAGG + Intergenic
975717848 4:77222390-77222412 AAACAGTGCTTACAGAGAACAGG - Intronic
976043406 4:80915056-80915078 AAGCAGTGCTTAGGGGAAAACGG - Intronic
979291992 4:118988723-118988745 CAGCTGTGCTTACAGAGAAAAGG - Intronic
979608051 4:122659977-122659999 GAGCAGAAGTTACAGGGATATGG + Intergenic
980328099 4:131374779-131374801 GAGCATTTTTTAAAGGGAAAGGG - Intergenic
983275011 4:165606153-165606175 GAGCAGTGCTTACCAGAAAGAGG - Intergenic
983564396 4:169133960-169133982 GATCAGTGCGTATGGGGAAATGG - Intronic
983823319 4:172225028-172225050 GAATAGTGCTTACAAGTAAATGG + Intronic
985873735 5:2579206-2579228 GATCAGTGCTCACAGGAGAAAGG - Intergenic
986119987 5:4826187-4826209 CACCAGTGTTTTCAGGGAAAAGG - Intergenic
988012237 5:25503888-25503910 AAGCAGCGCTTAGAGGAAAATGG - Intergenic
988693032 5:33591810-33591832 AATCAGTGGTGACAGGGAAAGGG + Intronic
989133271 5:38128161-38128183 GAGCAGTGCTTCCAGGACTATGG - Intergenic
989255298 5:39359781-39359803 GAGGAATGCTAACAAGGAAATGG - Intronic
990244205 5:53847361-53847383 AATCAGTGCTAAGAGGGAAATGG + Intergenic
991130505 5:63117571-63117593 GGGCAGTGAAGACAGGGAAAAGG - Intergenic
991485688 5:67134019-67134041 GAGGCATGCTTAAAGGGAAATGG - Intronic
994562120 5:101388304-101388326 GAGGAGTACTGACCGGGAAAGGG + Intergenic
995181416 5:109234262-109234284 GAGCAGGGCTTGCAAGGACAAGG - Intergenic
998680380 5:144460246-144460268 TAGAAGTCTTTACAGGGAAAAGG - Intronic
1001026943 5:168232493-168232515 GAGCAGTGATTACATGGAGCTGG - Intronic
1003300630 6:4878883-4878905 AAGCAATGTTCACAGGGAAATGG - Intronic
1003370862 6:5524624-5524646 AATCAGTTATTACAGGGAAAGGG - Intronic
1003772640 6:9323852-9323874 GAGCAATTCTAACAAGGAAAAGG + Intergenic
1003843455 6:10147114-10147136 GTACAGTGCTTCCTGGGAAATGG - Intronic
1003932940 6:10944627-10944649 AAGCAGTACTTAGAGAGAAATGG - Intronic
1005676708 6:28162395-28162417 AAGCAGTGCTTAAAGGCAACGGG + Intergenic
1006652932 6:35566449-35566471 GAGCTGAGCCTCCAGGGAAAGGG - Intergenic
1007792629 6:44320516-44320538 GAAGGGTGCTTGCAGGGAAATGG + Intronic
1013158131 6:107513469-107513491 GAGTTGTACTTGCAGGGAAATGG + Intronic
1014381161 6:120744029-120744051 TAGCAGTGTTAACAAGGAAAAGG + Intergenic
1015897516 6:138031631-138031653 GAGCAGTGCTCTCTGGGGAAAGG + Intergenic
1015989758 6:138926287-138926309 GTGGAGTGCTTAGAGGGAAGTGG - Intronic
1018274623 6:162117536-162117558 GAGCAGCCTTTACAGGGACATGG - Intronic
1018724580 6:166601624-166601646 CAGAAGTGCTTGCAGGTAAATGG + Intronic
1018839478 6:167507980-167508002 GAGAAGAGCTGACAGGGGAAGGG - Intergenic
1018839643 6:167508383-167508405 GAGGAGAGCTGACAGGGGAAGGG - Intergenic
1018839700 6:167508545-167508567 GAGGAGAGCTGACAGGGGAAGGG - Intergenic
1019589078 7:1820277-1820299 AGGCAGTGCTTAGAGGGAAACGG + Intronic
1020278674 7:6638849-6638871 GAGCAGTGTTTACAGTGGACTGG + Intronic
1023730079 7:43183235-43183257 GAGCTGTTCTCACAGGGGAAAGG - Intronic
1024360591 7:48463535-48463557 GAGCAGAGCATCCAGGGAAAAGG - Intronic
1024525438 7:50344880-50344902 GAGCAGTGCTTACACAGATGAGG + Intronic
1024537709 7:50451527-50451549 GAGAAGTGTTCAGAGGGAAAAGG - Intronic
1026126767 7:67586263-67586285 GAGGAGTGGATACTGGGAAAAGG + Intergenic
1026362703 7:69617418-69617440 GAGGAGAGCTTTCAAGGAAAGGG + Intronic
1026424734 7:70279300-70279322 GAGCAGTGCTTACCAGTAATGGG + Intronic
1034123535 7:148650433-148650455 GAGCAGCCCTTACAGGGAACAGG - Intergenic
1034378235 7:150665362-150665384 GAGTCATGCTTACAGGCAAAGGG + Intergenic
1034684650 7:152959265-152959287 AAGCAAAGCTGACAGGGAAAGGG + Intergenic
1035275404 7:157745330-157745352 GAGCAATGTTTACAGTGAGAGGG - Intronic
1037736825 8:21573911-21573933 GTGCAGTCCTCACAGGGTAAGGG - Intergenic
1039802015 8:40966129-40966151 GAGGAATGTTTACAGGCAAATGG + Intergenic
1039896218 8:41718562-41718584 GATCAGTGGTTTCAGGGAAGAGG - Intronic
1041044162 8:53876432-53876454 GACCAGTGCTTCCAGGAATACGG + Intronic
1045529106 8:102967609-102967631 GAGCTGTGTTTCCAGGCAAAGGG + Intronic
1045986711 8:108257504-108257526 GAGCAGAGCTTACTGTGGAAGGG - Intronic
1048029270 8:130615706-130615728 CAGCAGAGCTGAGAGGGAAAAGG - Intergenic
1048748316 8:137641468-137641490 GAGAAGTGCTGCCAGGAAAAGGG - Intergenic
1048924093 8:139255016-139255038 TAGCAGAGCTTAAAGGAAAAGGG + Intergenic
1050632362 9:7573634-7573656 GAGGAGAGCTTTCGGGGAAAAGG - Intergenic
1051588951 9:18756581-18756603 CAGCAATTCTTACTGGGAAAAGG + Intronic
1051748401 9:20317291-20317313 CAGCAGTGGTCACAGGGAAGAGG + Intergenic
1055858264 9:80718033-80718055 AAGGAGTGATTACAGGGAACTGG - Intergenic
1056779362 9:89538045-89538067 GAGCAGTGTGTACAGGGAGTGGG - Intergenic
1057204670 9:93164120-93164142 GGGCAGTGGAGACAGGGAAATGG + Intergenic
1059266340 9:113034921-113034943 GAGAAGTGCATACATGAAAAGGG - Intergenic
1059266349 9:113034967-113034989 GAGAAGTGCATACATGAAAAGGG - Intergenic
1059288547 9:113199916-113199938 GAGCACTGCATCCAGGGAAGAGG + Exonic
1060059035 9:120442561-120442583 GGGAAGTACTGACAGGGAAAGGG + Intronic
1060224830 9:121784332-121784354 GAGCAGGGCTCACTGGGCAATGG - Exonic
1061287152 9:129630536-129630558 GAGAAGTGGTCAGAGGGAAACGG - Intronic
1061945669 9:133907139-133907161 GAGCAGTGACGACAGGGAGATGG + Intronic
1062078897 9:134608350-134608372 GCTCAGTGGTTACAAGGAAAGGG - Intergenic
1186768961 X:12798728-12798750 GAGCCATCCTTACTGGGAAATGG - Intronic
1186898817 X:14031914-14031936 GAGAAATCCTTAGAGGGAAAGGG - Intergenic
1187777735 X:22782097-22782119 AAGCAGTACTAACAAGGAAAGGG + Intergenic
1190288474 X:48976072-48976094 GAGCAGTGCTTCCATGGCAGAGG - Exonic
1192905323 X:75544817-75544839 GAGCAGGGCTCACAGGGTGAAGG - Intergenic
1194240492 X:91440079-91440101 GACTAGTGCTTACAGTGTAAAGG + Intergenic
1195170428 X:102262073-102262095 GATCAGTGTGGACAGGGAAATGG - Intergenic
1195188431 X:102425027-102425049 GATCAGTGTGGACAGGGAAATGG + Intronic
1195293448 X:103451429-103451451 GAGCAGTGGTTGCCTGGAAATGG - Intergenic
1197827862 X:130609371-130609393 GAGCCGTGGTAACAGGGGAAGGG - Intergenic
1201458693 Y:14199148-14199170 GAGCAGATCTTACAGGGAAATGG - Intergenic