ID: 1075493422

View in Genome Browser
Species Human (GRCh38)
Location 10:122895021-122895043
Sequence CCTGAGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075493422_1075493428 -1 Left 1075493422 10:122895021-122895043 CCCTGCAACTTCTGCCTCTCAGG No data
Right 1075493428 10:122895043-122895065 GTTCAAGGGATTCTTGTAGCTGG No data
1075493422_1075493429 0 Left 1075493422 10:122895021-122895043 CCCTGCAACTTCTGCCTCTCAGG No data
Right 1075493429 10:122895044-122895066 TTCAAGGGATTCTTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075493422 Original CRISPR CCTGAGAGGCAGAAGTTGCA GGG (reversed) Intergenic
No off target data available for this crispr