ID: 1075495442

View in Genome Browser
Species Human (GRCh38)
Location 10:122915378-122915400
Sequence TTCTGCCCTCCTGCTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075495442_1075495454 29 Left 1075495442 10:122915378-122915400 CCCCCATTAGCAGGAGGGCAGAA No data
Right 1075495454 10:122915430-122915452 ACTCGGTTCCCATCCCAATTCGG No data
1075495442_1075495451 12 Left 1075495442 10:122915378-122915400 CCCCCATTAGCAGGAGGGCAGAA No data
Right 1075495451 10:122915413-122915435 GCTTTGGAGCCCTATGGACTCGG No data
1075495442_1075495450 6 Left 1075495442 10:122915378-122915400 CCCCCATTAGCAGGAGGGCAGAA No data
Right 1075495450 10:122915407-122915429 ACATGGGCTTTGGAGCCCTATGG No data
1075495442_1075495448 -4 Left 1075495442 10:122915378-122915400 CCCCCATTAGCAGGAGGGCAGAA No data
Right 1075495448 10:122915397-122915419 AGAACACCACACATGGGCTTTGG No data
1075495442_1075495447 -10 Left 1075495442 10:122915378-122915400 CCCCCATTAGCAGGAGGGCAGAA No data
Right 1075495447 10:122915391-122915413 GAGGGCAGAACACCACACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075495442 Original CRISPR TTCTGCCCTCCTGCTAATGG GGG (reversed) Intergenic
No off target data available for this crispr