ID: 1075495842

View in Genome Browser
Species Human (GRCh38)
Location 10:122917734-122917756
Sequence TCGTGGGGATCTCTAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075495842_1075495845 -8 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495845 10:122917749-122917771 CCCCACGAAGATCTTCCACTGGG No data
1075495842_1075495847 -7 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495847 10:122917750-122917772 CCCACGAAGATCTTCCACTGGGG No data
1075495842_1075495843 -9 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495843 10:122917748-122917770 TCCCCACGAAGATCTTCCACTGG No data
1075495842_1075495855 20 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495855 10:122917777-122917799 ACCCTTCCAGAAAGGAGTTGGGG No data
1075495842_1075495850 -5 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495850 10:122917752-122917774 CACGAAGATCTTCCACTGGGGGG No data
1075495842_1075495854 19 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495854 10:122917776-122917798 AACCCTTCCAGAAAGGAGTTGGG No data
1075495842_1075495852 12 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495852 10:122917769-122917791 GGGGGGCAACCCTTCCAGAAAGG No data
1075495842_1075495849 -6 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495849 10:122917751-122917773 CCACGAAGATCTTCCACTGGGGG No data
1075495842_1075495853 18 Left 1075495842 10:122917734-122917756 CCAGCTGCTAGAGATCCCCACGA No data
Right 1075495853 10:122917775-122917797 CAACCCTTCCAGAAAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075495842 Original CRISPR TCGTGGGGATCTCTAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr