ID: 1075496261

View in Genome Browser
Species Human (GRCh38)
Location 10:122922166-122922188
Sequence AGGGAGAGTGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075496252_1075496261 29 Left 1075496252 10:122922114-122922136 CCCTTGCAGTGGCTACATGGTAT No data
Right 1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG No data
1075496253_1075496261 28 Left 1075496253 10:122922115-122922137 CCTTGCAGTGGCTACATGGTATG No data
Right 1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG No data
1075496251_1075496261 30 Left 1075496251 10:122922113-122922135 CCCCTTGCAGTGGCTACATGGTA No data
Right 1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075496261 Original CRISPR AGGGAGAGTGCAGTGATTGT GGG Intergenic