ID: 1075498908

View in Genome Browser
Species Human (GRCh38)
Location 10:122954156-122954178
Sequence ATGGAGACGCGGACCGAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075498908_1075498912 -4 Left 1075498908 10:122954156-122954178 CCGTCCTCGGTCCGCGTCTCCAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1075498912 10:122954175-122954197 CCATTCCGCCGCCTTCAGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 60
1075498908_1075498916 11 Left 1075498908 10:122954156-122954178 CCGTCCTCGGTCCGCGTCTCCAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1075498916 10:122954190-122954212 CAGTCAGGCCAGCCCAGCCCCGG 0: 1
1: 1
2: 11
3: 70
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075498908 Original CRISPR ATGGAGACGCGGACCGAGGA CGG (reversed) Exonic
900129244 1:1080652-1080674 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129256 1:1080684-1080706 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129268 1:1080716-1080738 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129280 1:1080748-1080770 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129292 1:1080780-1080802 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129304 1:1080812-1080834 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129316 1:1080844-1080866 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129328 1:1080876-1080898 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129340 1:1080908-1080930 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129352 1:1080940-1080962 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900129364 1:1080972-1080994 AAGGAGACAGGGACCGAGGTGGG - Intergenic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
904062937 1:27725672-27725694 GTGGAGAGGCGGAGCGAGGGCGG + Intergenic
905857037 1:41321024-41321046 ATGGGAAGGCGGACAGAGGAGGG - Intergenic
910218192 1:84863572-84863594 AAGGAGAGGAGGACCAAGGATGG - Intronic
917478671 1:175391290-175391312 GTGGAGACGCTGGCCGAGGTAGG + Exonic
922816117 1:228450608-228450630 ATGGACACGTGCACCCAGGATGG - Intergenic
923339912 1:232998372-232998394 TTGAAGACGTGGACGGAGGAGGG - Exonic
1064332027 10:14402949-14402971 ATGGAGATGGGGACAGAGGGTGG + Intronic
1064497357 10:15926522-15926544 ATGGAGACCAGGACCGGGGGTGG - Intergenic
1073625216 10:105089815-105089837 ATGGAGGTGCGGACCACGGATGG + Exonic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075492046 10:122879851-122879873 GTGGACACGCGGTCCGAGGACGG + Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1076413170 10:130265923-130265945 ATGGAGACGGGGCCGGAGGAAGG + Intergenic
1085666067 11:78417127-78417149 ATGCAGCCGCGGACGGAGGGAGG + Intronic
1101970740 12:109310128-109310150 AAGGTGGCGCGGACCGCGGACGG + Intergenic
1102566041 12:113798131-113798153 ATGGAGACCCCGGCCCAGGAAGG - Intergenic
1103527556 12:121578503-121578525 ATGGACAGGCGGACCGAGGGAGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1132809887 16:1792418-1792440 TTGGGGAGGCGGCCCGAGGAGGG + Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1136181349 16:28554422-28554444 ACGAAGATGCGGACAGAGGATGG + Intronic
1137284580 16:47004604-47004626 ATGCAGACGGGGACCCAGTAGGG - Intergenic
1141202475 16:81908512-81908534 ATGGAGACGGGGGGCAAGGATGG + Exonic
1141690633 16:85594292-85594314 ATGGAGAAGCTGACCGCGGTGGG - Intergenic
1141771440 16:86092122-86092144 GAGGAGGCCCGGACCGAGGAAGG + Intergenic
1145989872 17:29072910-29072932 ATGAAGACAGGGACCGAGCAGGG + Intergenic
1146646273 17:34579368-34579390 ATGGACACGTGGACAGAGGAGGG + Exonic
1148109249 17:45135639-45135661 ATGGCGACGCAGATCGAGGGGGG - Intronic
1151703948 17:75757138-75757160 AAGGAGGCACGGCCCGAGGAGGG - Intronic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1163749199 19:19065197-19065219 GTGGAGACGCTGCCGGAGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166361183 19:42253682-42253704 ATTGGGACCCGGACCGAGGAGGG - Intronic
1167607942 19:50491460-50491482 ATGGAGAGGCGGAGCTGGGAAGG + Intergenic
1168688475 19:58362676-58362698 ACGCAGAGGCGGGCCGAGGACGG - Exonic
925439849 2:3876009-3876031 CTGAAGAGGCTGACCGAGGAAGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
935132739 2:100273149-100273171 ATGCAGCCGCTGGCCGAGGAAGG + Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
936267844 2:111023833-111023855 AAGGACACCCAGACCGAGGAGGG + Intronic
938310814 2:130287186-130287208 AGGGACCCGCAGACCGAGGAAGG + Intergenic
943795607 2:191989304-191989326 ATGGAAACTCAGACCAAGGATGG + Intronic
945431604 2:209771845-209771867 GAGGAGCCGCGGAGCGAGGAGGG - Intergenic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1174100982 20:48125999-48126021 ATGGAGCTGCGGACCCAGGGAGG - Intergenic
1179876992 21:44273599-44273621 ATGGACACACGGACCGTGGAAGG + Intergenic
1183523961 22:38313062-38313084 ATGGAGACGGGGACGGAGACTGG - Intronic
950765825 3:15272288-15272310 ATGGAGACCCGAACCAAGCATGG + Intronic
956796282 3:72721759-72721781 ATGGGGCTGGGGACCGAGGAAGG - Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
960787021 3:121384822-121384844 ATGGGGACGGGGACAGAGAAGGG - Intronic
961664897 3:128488889-128488911 AGGGAGCCCCGGGCCGAGGAGGG + Intronic
963854275 3:150238012-150238034 ATGGAGACTGGCACGGAGGAGGG + Intergenic
964092850 3:152896254-152896276 ATGGAGATGTGGTCCGAGAATGG + Intergenic
968518781 4:1026435-1026457 ATGGAGGCGGGGACTGAGGCGGG - Exonic
973774519 4:54231881-54231903 CTCGGGACGCGGACTGAGGAGGG + Intronic
981966830 4:150613958-150613980 ATGGACACGAGGTCAGAGGAAGG - Intronic
982068496 4:151674918-151674940 CTGCAGACGCAGACCCAGGAGGG - Intronic
985163145 4:187064348-187064370 ACTGAGATGCGGACCTAGGATGG - Intergenic
986717288 5:10533459-10533481 GTGGAGACGCTGGCAGAGGAGGG - Intergenic
992036786 5:72787461-72787483 ATGGAGACACGGACCGCTGTGGG + Intergenic
997383041 5:133450969-133450991 AGGGAGACAGGGACAGAGGAGGG + Intronic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
1000315551 5:160087084-160087106 ATGGAGACACTGGCCGAGCACGG + Intronic
1002596468 5:180327223-180327245 GTGGAGAGGCGGACAGAGGCCGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1009347916 6:62639554-62639576 ATGGAGACTCAGACCGTGTAGGG - Intergenic
1013632888 6:112002064-112002086 TTGGAGAGGCAGACCGAGAATGG + Intergenic
1015054433 6:128883032-128883054 ATGGGCACGCGGCCCCAGGACGG - Intergenic
1019524860 7:1476358-1476380 GCGGAGACGCGGAGCCAGGACGG - Exonic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1025233313 7:57217393-57217415 ATGGAGCCGCAGACCCAGGGAGG + Intergenic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1032522946 7:132560217-132560239 TTGGAGGCACGCACCGAGGAAGG + Intronic
1037941647 8:22955976-22955998 ATGGAGACGGGCACTAAGGAAGG + Intronic
1046397445 8:113658596-113658618 ATGAAGCCGCGGACCGTGGCAGG + Intergenic
1050524641 9:6534794-6534816 ACAGAGACACGGACAGAGGAGGG + Intronic
1052996072 9:34552212-34552234 ATGGGGACGCTGACCAAGAAGGG + Exonic
1059191727 9:112333485-112333507 ATGGAGGCGCGCACAGAGCAGGG + Intronic
1061719848 9:132544835-132544857 ATGGGGACGCTGCCTGAGGAGGG + Intronic
1062579127 9:137221880-137221902 TTGGAGGCGGGGACCGGGGAGGG - Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1198750462 X:139932676-139932698 CGGCAGCCGCGGACCGAGGAGGG - Intronic