ID: 1075499472

View in Genome Browser
Species Human (GRCh38)
Location 10:122959562-122959584
Sequence CAGTTCCCACAGATTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075499472_1075499474 17 Left 1075499472 10:122959562-122959584 CCAGTGGAAATCTGTGGGAACTG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1075499474 10:122959602-122959624 GTTGAAAGCTTCAGAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075499472 Original CRISPR CAGTTCCCACAGATTTCCAC TGG (reversed) Intronic
901151286 1:7104515-7104537 CAGTTCCCCCAGAGCTCCTCTGG - Intronic
903172780 1:21564036-21564058 CAATGCCCACAGATTTCCCTGGG - Exonic
904123011 1:28215445-28215467 CATTGCTCACAGGTTTCCACAGG - Intronic
904961224 1:34334622-34334644 CATTTGCCACAGATTTCCATGGG + Intergenic
904992104 1:34601414-34601436 GGGTTGCCACAGTTTTCCACTGG + Intergenic
908770500 1:67591513-67591535 AAGTTCCCACACAATTCCACGGG + Intergenic
908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG + Intergenic
909777252 1:79497077-79497099 CACATCAAACAGATTTCCACTGG - Intergenic
910108530 1:83657146-83657168 CAGTTTCCACTGATTCCCTCAGG + Intergenic
910536936 1:88309307-88309329 CAGTTCACACAGATGCTCACAGG - Intergenic
910849409 1:91636023-91636045 CTGTTTCCACTGATTTCCACTGG - Intergenic
911416574 1:97582272-97582294 CACTGCCCACAGATTTCCTCAGG - Intronic
912281407 1:108318616-108318638 CATTTGCCACACATTTCCATGGG - Intergenic
912963534 1:114216907-114216929 CAGTGCACAGAGATTTCCAAGGG + Intergenic
915794525 1:158714944-158714966 CAGTTCCTAAAGGTGTCCACTGG + Intergenic
915873603 1:159588364-159588386 CAGCTCACACAGATGTGCACTGG - Exonic
919689885 1:200519850-200519872 CACCACCCACACATTTCCACAGG - Intergenic
919831618 1:201544835-201544857 CACTTCCTTCAGATTTTCACTGG + Intergenic
921617206 1:217283323-217283345 CAGCTCCCACTCATTACCACTGG - Intergenic
1063075244 10:2710236-2710258 CAGTTGCCACTGCCTTCCACAGG + Intergenic
1069080322 10:64081666-64081688 CAGGTCCCACTGATCTTCACCGG - Intergenic
1075499472 10:122959562-122959584 CAGTTCCCACAGATTTCCACTGG - Intronic
1079254262 11:18813108-18813130 CTGTGCCCACAGATGCCCACAGG + Intergenic
1086052833 11:82614212-82614234 GAGTGACCACAGATTTCCCCAGG + Intergenic
1087712868 11:101574180-101574202 CAGTGCCCATATTTTTCCACAGG - Intronic
1087817686 11:102677483-102677505 CAGTTTCCATAAATCTCCACAGG - Intergenic
1089839559 11:121403829-121403851 CATTTACCACAGCTTTCCACCGG + Intergenic
1091488058 12:908690-908712 CAGTTCCCACAGGTTGGAACTGG - Exonic
1093700564 12:22215592-22215614 TGCTTCCCACAGATCTCCACAGG - Intronic
1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG + Intergenic
1096400942 12:51305687-51305709 CTTTCCCCAAAGATTTCCACAGG - Intronic
1099840395 12:87957425-87957447 CAGTTCCCAGATATTTTCATTGG + Intergenic
1102623902 12:114219101-114219123 CAGTCCCCTTGGATTTCCACTGG - Intergenic
1105615403 13:22007622-22007644 CAGGACCCACAGATTAGCACTGG + Intergenic
1105914854 13:24904228-24904250 AAATTCCCACTGATTTCCTCAGG - Intronic
1107778242 13:43871282-43871304 CAGTTCCAACAGACCTCCAATGG + Intronic
1108017011 13:46086617-46086639 CAGTTCCCACTGCGGTCCACGGG + Intronic
1109627894 13:65001310-65001332 TGGTTTTCACAGATTTCCACTGG + Intergenic
1109827526 13:67741743-67741765 CAGTTCTCTTAGATTTCCAGTGG - Intergenic
1110821242 13:79919421-79919443 TGGTTCCCACAGATTTCTATAGG - Intergenic
1112952382 13:105016071-105016093 CAGTTCCCAAGGATTTACAAGGG + Intergenic
1113520839 13:110939520-110939542 CAGTTCACACACGTTTCCAAGGG - Intergenic
1114926396 14:27405210-27405232 AAGTTCCCCCAAATTTCCATAGG - Intergenic
1119174098 14:72556538-72556560 CAATTCCCACAGAATGTCACTGG - Intronic
1127107525 15:55632654-55632676 CACCTCCCCCAGATATCCACAGG + Intronic
1127325073 15:57886852-57886874 CAGTTCCCACAGTTATGCAGGGG + Intergenic
1127664440 15:61131536-61131558 CAGTTCCTCCAGTTTTCCAGTGG - Intronic
1127829201 15:62735610-62735632 CAGTTCTTACAGATTGCCAGTGG + Intronic
1128842792 15:70863767-70863789 CAGTCCCCCTAGCTTTCCACAGG - Intronic
1130868562 15:87952554-87952576 CAGCTCCCACAGGCTTCCTCTGG + Intronic
1131900969 15:97087216-97087238 CAGTTTCCAAAGGTTTCCAAAGG - Intergenic
1136619140 16:31416449-31416471 CAGTTCCCACCTATTTCCAGTGG + Intronic
1137321873 16:47392326-47392348 CTCTTCCCCCAGATATCCACAGG - Intronic
1137768467 16:50995938-50995960 CAGTTCTCAGATATTTTCACAGG + Intergenic
1137785509 16:51134597-51134619 CACTTCCCTCAGATGTCCCCAGG + Intergenic
1139521245 16:67483774-67483796 CAGGGTCCACAAATTTCCACAGG + Exonic
1146911008 17:36648526-36648548 CAGCTCACACAGATTAACACTGG - Intergenic
1148698272 17:49574052-49574074 CACTTCCCACACATTTGCTCCGG - Intergenic
1151476790 17:74348739-74348761 CAGTCTCCAGAGAGTTCCACTGG - Intronic
1155062104 18:22237785-22237807 GAGGTCCCACAGGGTTCCACAGG - Intergenic
1157135688 18:45052426-45052448 CAGTGCTCCCAAATTTCCACTGG - Intronic
1157308911 18:46537319-46537341 CAGTTTCCCCATATTTACACAGG + Intronic
1157921567 18:51718461-51718483 CAGTTCCAACAGATTGAGACAGG + Intergenic
1159243482 18:65774704-65774726 CAGGCCCCACATCTTTCCACTGG - Intronic
1159307692 18:66666520-66666542 CATTACCCTCAGATTTCTACAGG + Intergenic
1159902983 18:74065266-74065288 CAGTTTCCATAGATTTTCCCAGG + Intergenic
927002562 2:18813634-18813656 CAGTTCCCACAACATTCCATAGG + Intergenic
928384939 2:30859078-30859100 CTTTCCCCACAGATTTCCAAGGG + Intergenic
930695414 2:54406701-54406723 CAGTTCCCACAGGATCTCACAGG + Intergenic
935234082 2:101123553-101123575 CAGCTTCCACAGATTGTCACGGG - Intronic
939790648 2:146570001-146570023 CAGTTCCAATCTATTTCCACAGG - Intergenic
940791077 2:158030981-158031003 CAGTTCCCTCAACTTTCCAAGGG + Intronic
943099702 2:183472707-183472729 CAGAAACCACAGATTTTCACTGG - Intergenic
943496968 2:188632253-188632275 CAGAGCCCACAGATCTTCACAGG + Intergenic
943806111 2:192128992-192129014 CAGTAGCCACACATTTCCTCTGG + Intronic
948018797 2:234713055-234713077 CTGTTCCCACAGGTGTCCATGGG - Intergenic
1170314027 20:15023857-15023879 CACTTCTCACACATTTTCACTGG + Intronic
1173329292 20:42060997-42061019 CAGTTTCCCCAGATTTCAAATGG + Intergenic
1173685987 20:44923928-44923950 CAGTTCTCACACATCTGCACTGG - Intronic
1173879642 20:46402286-46402308 CTGTGTCCACAGAATTCCACAGG + Intronic
1177613117 21:23479789-23479811 CTGTTCACTCAGATTTCCCCAGG - Intergenic
1177902147 21:26929992-26930014 CAGTTCTCACACACTTCCCCCGG + Exonic
1179644756 21:42768641-42768663 CAGCTCACACAGATGGCCACGGG + Intronic
1180024333 21:45150776-45150798 CAGTACACACACATTTCCAGAGG - Intronic
1183369753 22:37425811-37425833 CACGTCCCACAGGTGTCCACGGG + Intronic
1183469818 22:37999281-37999303 CAGTTCAGACACATTTCTACCGG + Intronic
1185090837 22:48772302-48772324 CAGGTTCCACGGAATTCCACAGG - Intronic
953367144 3:42354510-42354532 CTGTTCCCAGTGATTTCCTCGGG - Intergenic
953492578 3:43363812-43363834 CAAGTCCCACAGATTGTCACTGG - Intronic
956852254 3:73240352-73240374 CAGTTCTAATAGATTTCCTCTGG + Intergenic
957449516 3:80360325-80360347 CAGCTTCCACAGATTACAACTGG - Intergenic
958698922 3:97563293-97563315 TACTTCCCACAGATTTTCACAGG - Intronic
960492176 3:118331446-118331468 CTGTTCTCACATATTGCCACTGG + Intergenic
960870083 3:122239330-122239352 CTGTTCCCTCACCTTTCCACAGG - Intronic
961182747 3:124888805-124888827 CAGTTAGGACAGTTTTCCACTGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
964683964 3:159374429-159374451 TAGTACCCACAGATTCCCACAGG - Intronic
967658730 3:192079325-192079347 CAGGTGCCACAGTTTGCCACTGG - Intergenic
967791930 3:193559228-193559250 CAGTTCCTACAGCTTTCAAATGG - Intronic
969475511 4:7420483-7420505 CAGTGCCCCCACATGTCCACTGG - Intronic
973667265 4:53175087-53175109 CAATCCCCATAGAATTCCACAGG + Intronic
973949951 4:56002124-56002146 CAGTTCCCACAGTTTTTTAGTGG + Intronic
975507983 4:75160571-75160593 CAATTCCCAGAAAATTCCACCGG + Intergenic
977356779 4:95955591-95955613 AAGTTCCCTCTGATTTCCGCAGG - Intergenic
980765693 4:137301161-137301183 AAGTTCTCATTGATTTCCACGGG + Intergenic
982112902 4:152072593-152072615 CAGTTCCCAGAGGTTTCCAGGGG - Intergenic
982748572 4:159131901-159131923 AACTTCCCACACATTTCCTCTGG - Intronic
985991763 5:3567610-3567632 CAGTTGCCACTGATGTCCAGAGG + Intergenic
986161977 5:5238254-5238276 CAGGTCCCCCACATTTTCACAGG - Intronic
986425647 5:7628888-7628910 AAGGTCACACAGATTGCCACTGG - Intronic
988990999 5:36670957-36670979 CTGTTCCCATTGTTTTCCACTGG + Intronic
993289330 5:86044145-86044167 CAATTCCCACACATGACCACAGG - Intergenic
995412706 5:111876513-111876535 CAGTTCCCACAGACAGTCACAGG + Intronic
996878441 5:128265931-128265953 CATTTCAGACAGATTTCCCCCGG - Intronic
1003171460 6:3724698-3724720 GAGTTCCCACAGTTGTCCACGGG - Intronic
1006916687 6:37599242-37599264 TAGTTCCCCAAGATTCCCACAGG - Intergenic
1007252829 6:40507973-40507995 CAGTTTCCTCACCTTTCCACTGG - Intronic
1007600050 6:43075973-43075995 CAGTTCCCCCAGAATTCTCCAGG - Intergenic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1012429769 6:99152259-99152281 CACTCCCTACACATTTCCACTGG - Intergenic
1013846943 6:114464334-114464356 CTGGTACCACAAATTTCCACTGG - Intergenic
1014207100 6:118667829-118667851 TAGTTCACCCAGATTTACACTGG - Intronic
1015833503 6:137394647-137394669 TCGTTCCCACAGATCTCTACTGG + Intergenic
1016161286 6:140883817-140883839 AAGTTCCCACAGATTAACTCAGG - Intergenic
1016664755 6:146624389-146624411 CAGATCCCACAGATATCAAAGGG - Intronic
1017391543 6:153945370-153945392 CATTTCCCAAAAATTTCCAGTGG - Intergenic
1017871409 6:158489584-158489606 CTGTTCCCATAGATTTCATCTGG - Exonic
1018932935 6:168253847-168253869 CACATCCCACAGATGTGCACAGG - Intergenic
1020090238 7:5334722-5334744 CAGTCCCCCCAGAGATCCACTGG + Intronic
1020924249 7:14304594-14304616 CAGTTCACAGATATTTCCCCTGG + Intronic
1022048336 7:26641327-26641349 CAGAACCCACAGATATCCAGAGG - Intronic
1023124616 7:36943120-36943142 CAGTTCCCACATCTGTACACTGG + Intronic
1023196343 7:37643642-37643664 CATTACCCAGAGATATCCACTGG - Intergenic
1026748159 7:73028697-73028719 GAGTTCACACATATTTCCAATGG + Intergenic
1026751807 7:73056842-73056864 GAGTTCACACATATTTCCAATGG + Intergenic
1026755456 7:73084969-73084991 GAGTTCACACATATTTCCAATGG + Intergenic
1026759107 7:73112983-73113005 GAGTTCACACATATTTCCAATGG + Intergenic
1027034362 7:74914011-74914033 GAGTTCACACATATTTCCAATGG + Intergenic
1027088302 7:75280490-75280512 GAGTTCACACATATTTCCAATGG - Intergenic
1027091944 7:75308418-75308440 GAGTTCACACATATTTCCAATGG - Intergenic
1027095587 7:75336385-75336407 GAGTTCACACATATTTCCAATGG - Intergenic
1027323754 7:77031301-77031323 GAGTTCACACATATTTCCAATGG + Intergenic
1030741196 7:113111893-113111915 CTCTTCTCACATATTTCCACTGG - Intergenic
1030914691 7:115297813-115297835 CAGTTCACACATAGTTCCACTGG - Intergenic
1035906705 8:3519101-3519123 CAGTACCCAAATATTTGCACAGG - Intronic
1035938721 8:3872318-3872340 CAGTTCTCCCAGCTTTCCCCCGG + Intronic
1036391988 8:8331585-8331607 TAGTTCACACAAATTACCACTGG + Intronic
1038840864 8:31183562-31183584 CTGTTCCCCCAGATAACCACAGG + Intergenic
1043915720 8:85920222-85920244 CTCTTCCCCCAGATATCCACAGG + Intergenic
1044400425 8:91764418-91764440 CAGATTCCACAGATTTTCAGTGG - Intergenic
1047407019 8:124594176-124594198 TATTTCCCATAGATTGCCACTGG + Intronic
1054706428 9:68467168-68467190 TCTTTTCCACAGATTTCCACTGG - Intronic
1057784091 9:98073700-98073722 CAGTTCCCAGAGTGTCCCACAGG + Intronic
1059139817 9:111842523-111842545 CAGTTACCACACATTTTCAGTGG - Intergenic
1185520739 X:736609-736631 CAGTTCCCACAGACCTCCCCTGG + Intergenic
1186561550 X:10618752-10618774 CTGTTCCCACACAATTCCTCAGG - Intronic
1186659560 X:11655813-11655835 CAGTTCTCCCAGATTCCCAGAGG - Intronic
1188545888 X:31306489-31306511 AATTTCCCACAGATTTCCTTAGG + Intronic
1188870369 X:35364515-35364537 CCATTCCCACAGTGTTCCACTGG - Intergenic
1191184421 X:57593507-57593529 GATTTCCCACAGCCTTCCACAGG - Exonic
1191212968 X:57908952-57908974 GATTTCCCACAGCCTTCCACAGG + Exonic
1193057456 X:77168658-77168680 CCATTCCCACAGTATTCCACTGG + Intergenic
1195570515 X:106394267-106394289 CAGTTCCCACTGATTTTTATTGG - Intergenic
1198147194 X:133869014-133869036 CAGCTCTCACAGATTTTCAGTGG + Intronic
1200303925 X:155006347-155006369 CAGTTACCACAGCGTTCCTCTGG - Intronic
1200317461 X:155148559-155148581 CAGTTACCACAGCGTTCCTCTGG + Intergenic