ID: 1075502865

View in Genome Browser
Species Human (GRCh38)
Location 10:122993847-122993869
Sequence CCTTTTCAGTGTAATATATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075502865_1075502869 17 Left 1075502865 10:122993847-122993869 CCACATATATTACACTGAAAAGG 0: 1
1: 0
2: 2
3: 30
4: 303
Right 1075502869 10:122993887-122993909 ATCCCATATGAATAGTGTAAAGG 0: 1
1: 0
2: 1
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075502865 Original CRISPR CCTTTTCAGTGTAATATATG TGG (reversed) Exonic
906012460 1:42541519-42541541 CCTTCTCAGTGTATTTTATCAGG + Intronic
906466221 1:46082185-46082207 CCTTTTTAGTGTATTGTATTGGG - Intronic
907071232 1:51536814-51536836 CCTTCTCAGTGCATCATATGGGG + Intergenic
907559376 1:55374729-55374751 CCTTTTCTCTGTACTATTTGCGG - Intergenic
907610543 1:55865608-55865630 CCTATTCAGTGCAATAAATATGG + Intergenic
907636664 1:56141835-56141857 CCTTTTCAATGTAACATTTCTGG - Intergenic
908098907 1:60770647-60770669 CCTTTTCCATTTAAAATATGAGG + Intergenic
908918326 1:69158749-69158771 ACCTTTGAGTGTAATGTATGTGG + Intergenic
909026877 1:70492148-70492170 CCCATTCAGTGTAGTAGATGTGG - Intergenic
909210454 1:72816449-72816471 CCTTTTTGGTTTAATATCTGCGG - Intergenic
910025768 1:82649320-82649342 CATTTCCAGTGTATTCTATGAGG + Intergenic
910857665 1:91711830-91711852 CCTTTTCTGTGTGAAATATAAGG - Intronic
911766275 1:101678918-101678940 TCTTTTCAGCATAATATATGAGG + Intergenic
913142729 1:115957217-115957239 TTTTTTCAGTGTAAAATAGGGGG + Intergenic
915630648 1:157151769-157151791 TGTTTTCACTGTAATCTATGTGG + Intergenic
915926860 1:160028843-160028865 CCTTATCACTGTAATATTTCTGG - Exonic
917732016 1:177883900-177883922 CATTTTCTGTGTAATATTTTAGG + Intergenic
918949186 1:191113500-191113522 GATTTCCAGTGTCATATATGTGG - Intergenic
919405759 1:197181093-197181115 CCTTTTCCATGTGATATATGTGG - Exonic
921125540 1:212174479-212174501 CCTTATGAGTGCAATAAATGTGG + Intergenic
922117840 1:222631590-222631612 AATTTTCAGGGTAAAATATGAGG + Intronic
924737470 1:246771106-246771128 CCTTTTCAGTGTAGAGTCTGCGG - Intergenic
1063647747 10:7902565-7902587 CCTTTTCAGTGTGTTACATCAGG + Intronic
1065067061 10:21980366-21980388 CCTTTTCAGTGTATTGTATCAGG - Intronic
1066682900 10:37952455-37952477 CCCTTTGAATGTAATAAATGTGG - Exonic
1066700170 10:38119218-38119240 CCTTTTGGGTGTAATGAATGTGG + Exonic
1066999361 10:42592770-42592792 TCTTGTCAGTGTAATGAATGTGG - Exonic
1066999444 10:42593694-42593716 CCCTATCAGTGTAATGCATGTGG - Exonic
1067014494 10:42746818-42746840 CCTTTTTAGTGTATTGTATCAGG + Intergenic
1067136865 10:43616932-43616954 CCATATCAGTGTAATGAATGTGG + Exonic
1067305140 10:45056971-45056993 CCTTTTTAGTGTATCATATCAGG - Intergenic
1068293590 10:55037189-55037211 TCTTTTCAGTTTTAAATATGTGG + Intronic
1073896837 10:108170900-108170922 CCTTTTGTGTAAAATATATGGGG - Intergenic
1073896934 10:108172470-108172492 CCTTTTGTGTAAAATATATGGGG - Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1075552514 10:123402486-123402508 CCTTGTCATAGTAAAATATGGGG - Intergenic
1075581516 10:123622173-123622195 CCTTTTCAGTGGAATTTCAGTGG + Intergenic
1075903368 10:126061282-126061304 TCTATTCCATGTAATATATGTGG - Intronic
1077811573 11:5643230-5643252 CCTTTTCAGTGTTATAATTATGG + Exonic
1079557185 11:21774166-21774188 CCTGTTCAGTGTAAGATTAGTGG + Intergenic
1080483693 11:32680912-32680934 CCTTTTCAGTTGCAAATATGAGG + Intronic
1081028266 11:38043652-38043674 CCCATTCATTGTAATATATCAGG + Intergenic
1081923263 11:46799555-46799577 CCTTAATACTGTAATATATGCGG - Intronic
1082859846 11:57845254-57845276 ACTTTTCAGTTTATTCTATGAGG + Intergenic
1087019476 11:93588057-93588079 CCTTTTAAGTGACAAATATGTGG + Intergenic
1088554170 11:111044883-111044905 CCTTTTCATTGTATCATCTGTGG + Intergenic
1088631457 11:111777750-111777772 CCTTGCCAGTGAAATATTTGTGG - Intergenic
1090112058 11:123923004-123923026 CCTTTGCACTAAAATATATGTGG - Intergenic
1090145705 11:124320089-124320111 CCTGTTCCTTGGAATATATGTGG - Exonic
1094390504 12:29944379-29944401 CCTTTGCAGTGTGTTATATATGG + Intergenic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1097690433 12:62729480-62729502 ACTTTTCAGTGAATTATATGTGG + Intronic
1097919649 12:65057781-65057803 ACTTGTCAGTAAAATATATGGGG - Intronic
1098149570 12:67532427-67532449 CTTTTTCAGTATGATATTTGGGG - Intergenic
1098536037 12:71594512-71594534 TTCTTTCAGTGTAATCTATGAGG + Intergenic
1098752243 12:74309159-74309181 CCTGATCAGTGTAGAATATGAGG - Intergenic
1100559118 12:95730005-95730027 CCTTTTCAGTATAACATTTTTGG - Intronic
1103259249 12:119572050-119572072 CCTTTTAAGTTTAATCTACGTGG - Intergenic
1105539318 13:21301234-21301256 CATTTTTGGTGTAATTTATGTGG + Intergenic
1105569434 13:21587434-21587456 CCTTTTCAGTGCATCATATTAGG - Intronic
1105798974 13:23886669-23886691 CATTTTTAGTGTAATTTATGTGG - Intronic
1106373662 13:29162509-29162531 CCTTTTAAGGGTAGTACATGTGG + Intronic
1107251952 13:38374534-38374556 GTTTTTCAGTTTAATATATGAGG + Intergenic
1108504070 13:51094305-51094327 CCTTTTCAGTGCAATAAATGAGG + Intergenic
1114070868 14:19105422-19105444 CCTTTTTAGTGTATCATATCAGG - Intergenic
1114091393 14:19294583-19294605 CCTTTTTAGTGTATCATATCAGG + Intergenic
1114212703 14:20628774-20628796 CCTTTTCATTGTCTTAAATGTGG + Intergenic
1114255765 14:21000234-21000256 CCTTTTGAGAGGAATACATGAGG + Intronic
1114813382 14:25927424-25927446 CAGTTTCTGTGTACTATATGGGG - Intergenic
1115415363 14:33126442-33126464 CCATCTCAGAGTAATATCTGGGG - Intronic
1116039410 14:39667433-39667455 CTTTTTCTGTGTAAAATAAGAGG + Intergenic
1116373454 14:44166612-44166634 ATATTTCAGTGTAATAAATGAGG - Intergenic
1117461990 14:55954554-55954576 CCTTTTCTGTGTGGTATTTGAGG - Intergenic
1117944494 14:61004386-61004408 GCTTTTCAGTGTTACATATGGGG - Intronic
1121420811 14:93812447-93812469 CATTGTCCCTGTAATATATGAGG + Intergenic
1202847152 14_GL000009v2_random:188912-188934 CTATTTCAGTGCAATATTTGTGG - Intergenic
1202916615 14_GL000194v1_random:179474-179496 CTATTTCAGTGCAATATTTGTGG - Intergenic
1202876160 14_KI270722v1_random:3587-3609 CTATTTCAGTGCAATATTTGTGG + Intergenic
1123509687 15:20984632-20984654 CCTTTTCAGGGACATAGATGAGG + Intergenic
1123566907 15:21558371-21558393 CCTTTTCAGGGACATAGATGAGG + Intergenic
1123603170 15:21995664-21995686 CCTTTTCAGGGACATAGATGAGG + Intergenic
1125225186 15:37388371-37388393 CCTTATCAATGTATTATATCAGG + Intergenic
1126457473 15:48879255-48879277 CATTTTCAGTGTAAGATAAATGG + Exonic
1126827377 15:52565654-52565676 CCTTTTAAGAGTAAACTATGAGG - Intronic
1127322458 15:57860294-57860316 CCTTCTCAGTGTATCATATCAGG + Intergenic
1127453334 15:59137225-59137247 CCTTTTCAGTGTCCTCCATGGGG + Exonic
1128142211 15:65310151-65310173 CCTTTTCAGTGCATTACATCTGG - Intergenic
1129572347 15:76701417-76701439 CCTCTTAAGTGAAATTTATGTGG + Intronic
1131074795 15:89488515-89488537 CCTTTTCAGGGTATCACATGTGG - Intronic
1202975268 15_KI270727v1_random:285465-285487 CCTTTTCAGGGACATAGATGAGG + Intergenic
1133661473 16:7922140-7922162 TCTTTTTAATGTAATATGTGAGG - Intergenic
1133900451 16:9968914-9968936 TCTTTTTACTTTAATATATGTGG - Intronic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137887386 16:52119969-52119991 CTTTTTCAGTGAAATGTATTTGG - Intergenic
1139681104 16:68563964-68563986 CCTTTTGAATGTAGCATATGTGG + Exonic
1139681133 16:68564273-68564295 CCCTATCAATGTAATGTATGTGG + Exonic
1140047251 16:71449252-71449274 CCCTATCAGTGTAAGATGTGTGG - Exonic
1140265505 16:73417057-73417079 CCTTCTCAGGGTATTATATGCGG - Intergenic
1140789201 16:78374408-78374430 CATTTTCAGTATAATTTATTTGG + Intronic
1144594125 17:16552181-16552203 CCCTTTAAATGCAATATATGTGG - Exonic
1144601918 17:16623789-16623811 CCTTATCAGTGTAATGTGTGTGG - Exonic
1146142727 17:30381758-30381780 CTTTTTCAGTGTATTTTGTGAGG + Intronic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1149343439 17:55710399-55710421 CCTTTCCTGTGTAAAATAAGAGG - Intergenic
1150546737 17:66166442-66166464 TCTTTTCAGTGAAGTATACGTGG - Intronic
1151005189 17:70427491-70427513 CCTTTTCTCTGTCATATATGAGG - Intergenic
1151517033 17:74603169-74603191 CCTTTTCAGCTTAGTATATGCGG + Intergenic
1156188720 18:34693948-34693970 TCTTTTCAGTGTAATACATAAGG - Intronic
1156240152 18:35245891-35245913 CCTTATGAGTGTAATGAATGTGG + Exonic
1156240171 18:35246143-35246165 CCTTATCAGTGTAATGAATGTGG + Exonic
1156758851 18:40562047-40562069 CCTTTTCATTTTATGATATGAGG + Intergenic
1157009761 18:43632999-43633021 CCTTTTGATTTTAATATTTGTGG - Intergenic
1157349800 18:46874226-46874248 GCATTTCAGTGTAATCTATTTGG - Intronic
1157962080 18:52166106-52166128 CATTTTCAGTGACATATCTGTGG - Intergenic
1158036095 18:53032414-53032436 CCTTTTTCTTGTGATATATGAGG + Intronic
1158074224 18:53510168-53510190 GCTTTTCAGTGTACCATTTGAGG - Intronic
1159319879 18:66832927-66832949 CATGTTCAGTGAAATATATCAGG + Intergenic
1159624244 18:70673301-70673323 GTTTCTCAGTGGAATATATGGGG + Intergenic
1159967408 18:74608813-74608835 CCTTCTCAGTGCATCATATGAGG + Intronic
1160042172 18:75355424-75355446 CGTTTTCATTGAAGTATATGAGG + Intergenic
1162103647 19:8356210-8356232 CCTTCTCAGTGTATGATATCAGG - Intronic
1162247456 19:9413936-9413958 CCCTTTGAATGTAAGATATGTGG - Exonic
1162284003 19:9724297-9724319 CCCTATCAGTGTAACAAATGTGG - Intergenic
1162619717 19:11832191-11832213 CCTTATGAATGTAAGATATGTGG + Exonic
1162619793 19:11832982-11833004 CCTTATAAATGTAAGATATGTGG + Exonic
1162628450 19:11905472-11905494 CCTTATGAATGTAAGATATGTGG + Intronic
1162629067 19:11911856-11911878 CCTTATAAATGTAAGATATGTGG + Intronic
1162633691 19:11949105-11949127 CCTTATAAATGTAAGATATGTGG + Exonic
1162637321 19:11979892-11979914 CCTTATAAATGTAAGATATGTGG + Intergenic
1162669894 19:12247758-12247780 CCCTTTGAGTGTAAAAAATGTGG - Intronic
1162686636 19:12391370-12391392 CCTCATAAGTGTAAGATATGTGG - Exonic
1163803877 19:19384879-19384901 CCTTTTCCGAGGAATATTTGGGG - Intergenic
1163853359 19:19679998-19680020 CCTTATGAATGTAATAAATGTGG + Exonic
1163857057 19:19711671-19711693 CCTTTTGAGTGTAAGCAATGTGG - Exonic
1164045557 19:21536567-21536589 CCTTTCCAGTGTAAAAAATGTGG + Exonic
1165543595 19:36514058-36514080 CCTTATCAGTGTAGTGAATGTGG - Exonic
1165589101 19:36950738-36950760 CCTTATCATTGTAATCAATGTGG + Exonic
1165643646 19:37413327-37413349 CCTTATGAGTGTAATGAATGTGG - Exonic
1165659650 19:37565742-37565764 CCTTATCAGTGTAACGCATGTGG - Exonic
1165684170 19:37803864-37803886 CCCTTTCAATGTAACAAATGTGG + Intronic
1166576721 19:43847721-43847743 CCTTATGAATGTAAAATATGTGG + Exonic
1167819669 19:51915736-51915758 CCTTATGAGTGCAATAAATGTGG - Intronic
1167835581 19:52065990-52066012 CCTTTCCAGTGTAACGAATGCGG - Exonic
1167835596 19:52066158-52066180 CCTCTCCATTGTAATAAATGTGG - Exonic
1167845073 19:52155920-52155942 CCTTTCCAATGTAATGAATGTGG - Exonic
1167845129 19:52156592-52156614 CCATATCAATGTGATATATGTGG - Exonic
1167892786 19:52555704-52555726 TCTTCTGAGTGTAATAAATGTGG + Exonic
1167965380 19:53140768-53140790 CCTTACCAGTGTAATGAATGTGG - Exonic
1167968187 19:53165855-53165877 CCTTACCAGTGTAATAAGTGTGG - Exonic
1167977151 19:53237753-53237775 CCATATCAATGTAATATATGTGG - Exonic
1167990172 19:53353331-53353353 CCTTACAAGTGTAATAAATGTGG + Exonic
1168006329 19:53491376-53491398 CCTTATAAGTGTAATGAATGTGG + Exonic
1168421792 19:56208856-56208878 CTCTTTCAGTGTAATCTCTGCGG + Exonic
1168457521 19:56525355-56525377 CCTTATGAATGTGATATATGTGG + Exonic
1168457545 19:56525691-56525713 CCTTATGAGTGTAATGAATGCGG + Exonic
1168531751 19:57135567-57135589 CCCTATCAGTGTAAGACATGTGG - Exonic
1168574079 19:57493749-57493771 CCTTTTAAGTGCAATGAATGTGG + Exonic
1168574097 19:57493917-57493939 CCTTTTAAGTGCAATGAATGTGG + Exonic
1168575738 19:57507251-57507273 CCTTTTAAGTGCAATGAATGTGG + Exonic
1168579015 19:57537824-57537846 CCTTATGTGTGCAATATATGTGG + Exonic
1168652361 19:58099322-58099344 CCTTCACAGTGTCATATAAGTGG + Intronic
1202674500 1_KI270710v1_random:29226-29248 CTATTTCAGTGCAATATTTGTGG - Intergenic
927787696 2:25984915-25984937 TTTTTTCAGTGGAATAAATGAGG + Intergenic
927829494 2:26336883-26336905 CCATTTCAGTGGCATCTATGGGG + Intronic
930312599 2:49760186-49760208 GCTTTGGAGTGAAATATATGAGG - Intergenic
930731878 2:54735736-54735758 CCCTTTCAATGTAAGAAATGTGG + Intronic
934545812 2:95215028-95215050 CCTTATGAGTGTAATGAATGTGG + Exonic
935794126 2:106624304-106624326 CCTTATCAGTCAAATGTATGGGG - Intergenic
935888030 2:107645855-107645877 GCCTTTCACTGTACTATATGAGG - Intergenic
937442658 2:121930165-121930187 CCTGTTCAGTGTAATGTACCTGG + Intergenic
938575688 2:132601496-132601518 CCAGTTCAGTATGATATATGCGG - Intronic
939403106 2:141720462-141720484 CATTTTCTGTCTACTATATGAGG - Intronic
939618597 2:144389914-144389936 CCCTATCAGTGTGATAAATGTGG - Exonic
940281023 2:151989756-151989778 CATGTTGAGTCTAATATATGTGG - Intronic
941518138 2:166505300-166505322 CCTTTACAGTGAATTATATCAGG - Intergenic
942526553 2:176859394-176859416 CATTTCCACAGTAATATATGAGG - Intergenic
943401873 2:187422862-187422884 AATTTTTAGTGTAAAATATGAGG + Intronic
944251809 2:197586232-197586254 ACTTTTCACTGTTATTTATGGGG - Intronic
944398639 2:199299638-199299660 TTTTTTCACTGTTATATATGTGG + Intronic
944866129 2:203864158-203864180 CCTTCTCAGTGTATTGTATCTGG + Intergenic
945234715 2:207623949-207623971 CCTTTAAAATGTAATCTATGTGG + Intronic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
1172107301 20:32524469-32524491 CTTTTTCAGTGCACTAAATGAGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174643336 20:52064183-52064205 CCTTTTTAGTGTATCATATCAGG - Intronic
1176635970 21:9194121-9194143 CTATTTCAGTGCAATATTTGTGG - Intergenic
1176637438 21:9260960-9260982 CTATTTCAGTGCAATATTTGTGG + Intergenic
1176855462 21:13965479-13965501 CATTTTTTGTTTAATATATGAGG - Intergenic
1176912556 21:14584101-14584123 TCTTTGCAGTGTAATATAGATGG + Intergenic
1177759317 21:25384760-25384782 CCATTTCAGTGTTACATATTGGG + Intergenic
1180421475 22:12868457-12868479 CTATTTCAGTGCAATATTTGTGG + Intergenic
1180489333 22:15827888-15827910 CCTTTTTAGTGTATCATATCAGG - Intergenic
1181543443 22:23587142-23587164 CCTTTTCTGTGCAGTATCTGGGG + Intergenic
1181566904 22:23744368-23744390 CCTTATCAGTGTAAGGAATGTGG - Exonic
1183713122 22:39518283-39518305 CCTTTTCAGTGTCAAAATTGGGG + Intergenic
949396972 3:3625119-3625141 ACTTTTTAGTGGAATATGTGAGG - Intergenic
949662746 3:6299394-6299416 CCTTTACAATGTCAAATATGAGG + Intergenic
952731226 3:36638591-36638613 CCTGTTCTGTTTAATATATAGGG - Intergenic
953616974 3:44499863-44499885 CCTTATAAGTGTAATGAATGTGG - Exonic
953633622 3:44642571-44642593 CCTTATAAGTGTAATGAATGTGG + Exonic
953638471 3:44683959-44683981 CCATTTGAGTGTAATGAATGCGG - Intergenic
953643831 3:44734902-44734924 CCTTTTAAGTGTAATGAATGTGG + Exonic
954586309 3:51739860-51739882 GCATTTCAGTGTAATTTATTTGG - Intergenic
955896459 3:63705879-63705901 CCTTTTCCTTCTAATATATTAGG - Intergenic
957875518 3:86140851-86140873 TATTTTCAGTGTAAAATATTGGG + Intergenic
957989356 3:87610312-87610334 GCATTTCAGTGTAATCTATTTGG + Intergenic
959065484 3:101652657-101652679 TATTTTAGGTGTAATATATGTGG - Exonic
959356889 3:105343041-105343063 CCTTCTCATTGTAGTATATCAGG - Intergenic
960025927 3:113009296-113009318 CCTTTTGAGTGTAAGAAATTTGG - Intronic
961142970 3:124571016-124571038 GGATTTCAGTGCAATATATGAGG - Intronic
961972789 3:130988332-130988354 CCTTTTCAGTGTCACATTTGTGG - Intronic
962002565 3:131313947-131313969 ACTTTTCAGTACAATATATTGGG + Intronic
962029100 3:131580871-131580893 CCTGTCCAGTGTTTTATATGTGG - Intronic
963535104 3:146517963-146517985 CCTTTTCAGCTAAATAAATGTGG + Intronic
965346712 3:167559781-167559803 CCTTTTCAGTGTAGTCAATAGGG - Intronic
1202749457 3_GL000221v1_random:144060-144082 CTATTTCAGTGCAATATTTGTGG - Intergenic
969041988 4:4306146-4306168 CCTTTTGAATGTAACATTTGTGG + Exonic
970017395 4:11527681-11527703 CAGTTTAAGTGTAATATTTGAGG - Intergenic
970469353 4:16361148-16361170 CCCTATCAGTGTGATAAATGTGG - Intergenic
970565605 4:17329472-17329494 CTTTTTCAGTGTCAGATATTTGG - Intergenic
970649641 4:18162098-18162120 CCTTATCATTGCAATATATGAGG - Intergenic
970814126 4:20133733-20133755 ATTTTTCAATGTATTATATGAGG + Intergenic
971581492 4:28347152-28347174 CATTTTAAGAGAAATATATGTGG + Intergenic
971585192 4:28396726-28396748 AGTTTTCAGTGTAATATAATGGG - Intronic
973960648 4:56106546-56106568 CCCTTTCAGTGTTAGCTATGTGG + Intergenic
974389651 4:61249714-61249736 CCTTTTCAATTTTATTTATGGGG - Intronic
974625453 4:64421332-64421354 CCTTTTGAATGTTGTATATGAGG - Intergenic
975736223 4:77383759-77383781 CCTTATCAGGGTGCTATATGGGG + Intronic
975796701 4:78013752-78013774 CCTTTTCTAGGTAATATTTGTGG + Intergenic
977067791 4:92341150-92341172 CCTTTTTTATTTAATATATGTGG + Intronic
977795816 4:101163313-101163335 TCTTTTCAGTGTGAAATATCTGG + Intronic
978113419 4:104990423-104990445 CCTCTCCAATGTATTATATGTGG - Intergenic
978214198 4:106178426-106178448 CCTATTCAGTGTAGTAGCTGTGG + Intronic
978694341 4:111558700-111558722 CCTATTCAGTGTGATAACTGTGG + Intergenic
979145584 4:117243065-117243087 ACTTTAAAGTGTAATATATAAGG + Intergenic
980712491 4:136588916-136588938 CCTTTTTAGTGTATAGTATGAGG - Intergenic
981545846 4:145892370-145892392 CCTTTCCAGTGTCCAATATGTGG - Exonic
981918640 4:150062347-150062369 CCTTTTCCGTTTAAAATATGAGG - Intergenic
981976246 4:150731982-150732004 TCTTTTCGTTGTAATATTTGTGG - Intronic
983167079 4:164490917-164490939 TTTGTTCTGTGTAATATATGAGG + Intergenic
983971099 4:173875451-173875473 TCTTTTATGTGTAATATATATGG - Intergenic
1202752331 4_GL000008v2_random:19376-19398 CTATTTCAGTGCAATATTTGTGG + Intergenic
986249425 5:6043178-6043200 CCTTTTCAGTGCAATGGGTGGGG - Intergenic
987688595 5:21238041-21238063 CCATTTTATTATAATATATGTGG + Intergenic
989082604 5:37640262-37640284 GTTTTTCAGTGTTAGATATGTGG - Intronic
989527189 5:42467116-42467138 CCTTTTGTGTGTAATGAATGTGG - Intronic
989630584 5:43478096-43478118 CCTGTTCAATGTAATATATTTGG - Intronic
991278986 5:64888968-64888990 CCTTCTCAGTGCATTATATCAGG - Intronic
991864154 5:71042180-71042202 CCTGTTGAGTGTAAAATCTGTGG - Exonic
992744858 5:79809541-79809563 CCTTTTCAGTGGACTATACCTGG - Intergenic
993069520 5:83142277-83142299 CCATTTCAGTGTTATGGATGAGG + Intronic
994587540 5:101729030-101729052 GGTTTCCAGTGTAATAAATGTGG + Intergenic
995291402 5:110459820-110459842 CCTTCTCAGTGTATCATATCAGG - Intronic
996266871 5:121551895-121551917 CCTTTTCCCTGAAATATATCAGG - Intergenic
1000167193 5:158663201-158663223 TGTTTTAAGTGTCATATATGAGG - Intergenic
1000551579 5:162672253-162672275 CCTTTTCAATGTATTATCTTGGG - Intergenic
1000566584 5:162855343-162855365 CCTTTTCAGGGTAATTTTTGAGG - Intergenic
1002366061 5:178712211-178712233 CCCTTTAAATGTAATACATGTGG - Exonic
1002387967 5:178884097-178884119 CCCTTTAAATGTAATACATGTGG + Exonic
1002393158 5:178931698-178931720 CCCTATAAGTGTAATGTATGTGG + Exonic
1002393232 5:178932622-178932644 CCCTATCAGTGTAATGAATGCGG + Exonic
1005675777 6:28153325-28153347 CCCTATCAGTGTAATGTGTGTGG + Exonic
1005887784 6:30110283-30110305 CATTTTCATTCTAATACATGCGG + Intronic
1007341958 6:41196441-41196463 CCTTTTCTATCTAATAAATGTGG + Intronic
1008760606 6:54847607-54847629 CCTATTCTGTGTGATATGTGGGG + Intronic
1010168759 6:72949787-72949809 GCTTTCCAGTGTAATTTTTGTGG - Intronic
1013142659 6:107354242-107354264 CCTTGTCAGATTAATATTTGTGG - Intronic
1014111169 6:117619826-117619848 CCGTTTTAGTGAAATAGATGAGG - Intergenic
1014284816 6:119485124-119485146 CCTTTTTAGTGTATAATTTGAGG + Intergenic
1014502967 6:122215547-122215569 TATTGTCAGTGTAAAATATGGGG - Intergenic
1014968697 6:127788635-127788657 CCTTTTCAAGAAAATATATGGGG - Intronic
1015200725 6:130576960-130576982 AATTTTCAGTGTCACATATGGGG + Intergenic
1015218757 6:130780517-130780539 ATTTTTGAGTGTAATTTATGTGG - Intergenic
1020048623 7:5064318-5064340 CCTTATGAATGTAATGTATGTGG + Exonic
1020764377 7:12302258-12302280 CCTTTTCAGAGTTATCCATGTGG + Intergenic
1021286270 7:18784791-18784813 TCTGTTAAGTGAAATATATGTGG - Intronic
1024531917 7:50400532-50400554 CCTTTTGAGTGCAACATGTGCGG + Exonic
1024763362 7:52627803-52627825 CCTAGTCATTGTTATATATGTGG - Intergenic
1027401373 7:77811249-77811271 ACTTTCCAGTGCATTATATGAGG + Intronic
1027830951 7:83177070-83177092 CCTTCTCATTGTATTATATTAGG - Intergenic
1028398121 7:90394714-90394736 CCTTTTGGGAGTAAAATATGAGG + Intronic
1029288928 7:99486892-99486914 CCTTTTGAGTGTAAGGTCTGTGG + Exonic
1029294831 7:99531875-99531897 CCTTATCAGTGTGATATCTGTGG + Exonic
1029294850 7:99532127-99532149 CCTTTTCAATGTAAAGAATGTGG + Exonic
1029357652 7:100064354-100064376 CCTTATCAGTGTAACGAATGTGG + Exonic
1030392913 7:108949255-108949277 CCTTTCAAGTGTAATATTAGTGG - Intergenic
1031747390 7:125518648-125518670 AATTATCAGTGTAATATATCTGG - Intergenic
1031755085 7:125629019-125629041 TTTCTTCAGTTTAATATATGGGG + Intergenic
1032243721 7:130188819-130188841 CCTTTTCAGTGTATCACATCAGG - Intronic
1032301623 7:130692554-130692576 CCTTTGCAGGGAAATAGATGAGG - Intergenic
1036706434 8:11050366-11050388 CCTCATCAGTGTAAAATAAGGGG + Intronic
1037057447 8:14459725-14459747 CCTTTTCAGTGTATCATATTAGG - Intronic
1037577471 8:20221371-20221393 CCTTTTCAGGGTAATCTTTGTGG + Exonic
1039291546 8:36100103-36100125 ACTGTACAGTGTAATATATATGG + Intergenic
1040098723 8:43477086-43477108 CCTTTTCAGTGTACCATATTAGG - Intergenic
1040621818 8:49100275-49100297 GCATTTCAGTGTAATCTATTTGG - Intergenic
1041437191 8:57855208-57855230 CTTTTACAGTCAAATATATGGGG - Intergenic
1041709828 8:60884313-60884335 CCTTTTGACTGAAATATCTGGGG + Intergenic
1042154652 8:65830571-65830593 CGTTTTCAGTGGGATAGATGGGG - Intronic
1044798112 8:95924712-95924734 CCTTTTCATTGAAATAAAAGGGG - Intergenic
1045453938 8:102357140-102357162 CCTTTTCAGTGCATCATATCAGG - Intronic
1048190933 8:132288169-132288191 CATTCTCAGTGTAAAATATATGG + Intronic
1048312575 8:133336945-133336967 CCTATGCATTGTAAAATATGTGG - Intergenic
1048655093 8:136527342-136527364 CATGTTCAGTGGATTATATGAGG + Intergenic
1048799173 8:138180501-138180523 GCTTTTGGGTGTAAAATATGAGG + Intronic
1049461334 8:142729763-142729785 TCCTTTCAGTGAAATAGATGAGG + Intronic
1049874305 8:145005810-145005832 CCTTATCAGTGTAACAAACGTGG - Intergenic
1055295810 9:74832042-74832064 TCTTTCCCTTGTAATATATGGGG - Intronic
1055916875 9:81412008-81412030 ACTTTTAACTGCAATATATGAGG + Intergenic
1056623025 9:88230457-88230479 CCATTTCAGTGAAAAAAATGTGG + Intergenic
1056728982 9:89147683-89147705 CCTTTTTGGTGTAATAAAAGGGG - Intronic
1057635269 9:96758929-96758951 CCCTTTCAGTGTAATAAATGTGG - Exonic
1057640748 9:96818572-96818594 CCTTTTGAATGTAATGAATGCGG - Exonic
1058145669 9:101408291-101408313 CCTTTTCAGTGCAATGAATGTGG + Exonic
1058261971 9:102845107-102845129 GCTTTTCAGTTTAATCTATGTGG - Intergenic
1059263095 9:112998120-112998142 CCTTATGAATGTAAAATATGTGG - Intergenic
1059383747 9:113948412-113948434 ACTTTTCTGTGGAATATATCAGG + Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1061474417 9:130854444-130854466 CCTTTTCAGTATAAAAAATAGGG - Intronic
1203718098 Un_KI270742v1:174151-174173 CTATTTCAGTGCAATATTTGTGG - Intergenic
1203629661 Un_KI270750v1:60263-60285 CTTTTTTAATGTAAGATATGAGG + Intergenic
1203652323 Un_KI270751v1:137700-137722 CTATTTCAGTGCAATATTTGTGG - Intergenic
1186961264 X:14738804-14738826 CCTGTTCAGTGGCATAGATGAGG - Intergenic
1187235742 X:17465370-17465392 TCTTTTCTGTGTATCATATGTGG + Intronic
1188122655 X:26328195-26328217 CCTCTTCAGTAGAATATATAAGG - Intergenic
1189606770 X:42686498-42686520 CCTTTTCAGGTTAGTAAATGTGG + Intergenic
1189977159 X:46473497-46473519 CCTTATGAATGTAATAAATGTGG + Exonic
1190088057 X:47413142-47413164 CCCTATCAGTGTAATGAATGTGG + Exonic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1191710540 X:64145871-64145893 CCCTATCAGTGTAAGAAATGTGG - Intergenic
1195960688 X:110383199-110383221 CTTTCTCAGTTGAATATATGAGG + Intronic
1197057404 X:122137020-122137042 CATTTTCAGTGTATTATGTCAGG - Intergenic
1198706607 X:139455742-139455764 CCTTCTCAGTGTATCATATCAGG + Intergenic
1199449177 X:147960226-147960248 CCTTCTCAGTGCATCATATGAGG - Intergenic
1200853727 Y:7913913-7913935 ACTTGTCAGTGTAATAAATGTGG - Intergenic
1201172256 Y:11279000-11279022 CTATTTCAGTGCAATATTTGTGG - Intergenic