ID: 1075504481

View in Genome Browser
Species Human (GRCh38)
Location 10:123009569-123009591
Sequence TAAGGGACTTCGGAGTTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075504478_1075504481 -8 Left 1075504478 10:123009554-123009576 CCCGCTCAAAGGTAGTAAGGGAC 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data
1075504479_1075504481 -9 Left 1075504479 10:123009555-123009577 CCGCTCAAAGGTAGTAAGGGACT 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data
1075504469_1075504481 13 Left 1075504469 10:123009533-123009555 CCCTGTCCTTCCTTCCGCGGCCC 0: 1
1: 0
2: 0
3: 15
4: 275
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data
1075504477_1075504481 -7 Left 1075504477 10:123009553-123009575 CCCCGCTCAAAGGTAGTAAGGGA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data
1075504471_1075504481 7 Left 1075504471 10:123009539-123009561 CCTTCCTTCCGCGGCCCCGCTCA No data
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data
1075504470_1075504481 12 Left 1075504470 10:123009534-123009556 CCTGTCCTTCCTTCCGCGGCCCC 0: 1
1: 0
2: 0
3: 32
4: 409
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data
1075504472_1075504481 3 Left 1075504472 10:123009543-123009565 CCTTCCGCGGCCCCGCTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data
1075504474_1075504481 -1 Left 1075504474 10:123009547-123009569 CCGCGGCCCCGCTCAAAGGTAGT 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075504481 Original CRISPR TAAGGGACTTCGGAGTTGTT CGG Intronic
No off target data available for this crispr