ID: 1075510555

View in Genome Browser
Species Human (GRCh38)
Location 10:123069230-123069252
Sequence GCACCATGGTGAGCTGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075510555_1075510563 16 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510563 10:123069269-123069291 AGAAGGAGATAAAAGGGGGGAGG No data
1075510555_1075510565 18 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510565 10:123069271-123069293 AAGGAGATAAAAGGGGGGAGGGG No data
1075510555_1075510561 12 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510561 10:123069265-123069287 AAAGAGAAGGAGATAAAAGGGGG No data
1075510555_1075510557 -1 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510557 10:123069252-123069274 CATTTCAACTTATAAAGAGAAGG No data
1075510555_1075510560 11 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510560 10:123069264-123069286 TAAAGAGAAGGAGATAAAAGGGG No data
1075510555_1075510562 13 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510562 10:123069266-123069288 AAGAGAAGGAGATAAAAGGGGGG No data
1075510555_1075510559 10 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510559 10:123069263-123069285 ATAAAGAGAAGGAGATAAAAGGG No data
1075510555_1075510564 17 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510564 10:123069270-123069292 GAAGGAGATAAAAGGGGGGAGGG No data
1075510555_1075510558 9 Left 1075510555 10:123069230-123069252 CCAGTTACAGCTCACCATGGTGC No data
Right 1075510558 10:123069262-123069284 TATAAAGAGAAGGAGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075510555 Original CRISPR GCACCATGGTGAGCTGTAAC TGG (reversed) Intergenic
No off target data available for this crispr