ID: 1075512105

View in Genome Browser
Species Human (GRCh38)
Location 10:123081096-123081118
Sequence CACAGCAGGCACAGTGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075512105_1075512110 -9 Left 1075512105 10:123081096-123081118 CCCTAGGCACTGTGCCTGCTGTG No data
Right 1075512110 10:123081110-123081132 CCTGCTGTGCCTGATGGGTATGG No data
1075512105_1075512112 13 Left 1075512105 10:123081096-123081118 CCCTAGGCACTGTGCCTGCTGTG No data
Right 1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075512105 Original CRISPR CACAGCAGGCACAGTGCCTA GGG (reversed) Intergenic