ID: 1075512109

View in Genome Browser
Species Human (GRCh38)
Location 10:123081110-123081132
Sequence CCATACCCATCAGGCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075512109_1075512112 -1 Left 1075512109 10:123081110-123081132 CCTGCTGTGCCTGATGGGTATGG No data
Right 1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG No data
1075512109_1075512116 24 Left 1075512109 10:123081110-123081132 CCTGCTGTGCCTGATGGGTATGG No data
Right 1075512116 10:123081157-123081179 TGAAGTTTCCAATCTTTCCCCGG No data
1075512109_1075512117 25 Left 1075512109 10:123081110-123081132 CCTGCTGTGCCTGATGGGTATGG No data
Right 1075512117 10:123081158-123081180 GAAGTTTCCAATCTTTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075512109 Original CRISPR CCATACCCATCAGGCACAGC AGG (reversed) Intergenic