ID: 1075512111

View in Genome Browser
Species Human (GRCh38)
Location 10:123081119-123081141
Sequence TCAGGGCAGCCATACCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075512111_1075512116 15 Left 1075512111 10:123081119-123081141 CCTGATGGGTATGGCTGCCCTGA No data
Right 1075512116 10:123081157-123081179 TGAAGTTTCCAATCTTTCCCCGG No data
1075512111_1075512112 -10 Left 1075512111 10:123081119-123081141 CCTGATGGGTATGGCTGCCCTGA No data
Right 1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG No data
1075512111_1075512119 30 Left 1075512111 10:123081119-123081141 CCTGATGGGTATGGCTGCCCTGA No data
Right 1075512119 10:123081172-123081194 TTCCCCGGGAGTTTATTTCAAGG No data
1075512111_1075512117 16 Left 1075512111 10:123081119-123081141 CCTGATGGGTATGGCTGCCCTGA No data
Right 1075512117 10:123081158-123081180 GAAGTTTCCAATCTTTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075512111 Original CRISPR TCAGGGCAGCCATACCCATC AGG (reversed) Intergenic