ID: 1075512112

View in Genome Browser
Species Human (GRCh38)
Location 10:123081132-123081154
Sequence GCTGCCCTGACCTGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075512105_1075512112 13 Left 1075512105 10:123081096-123081118 CCCTAGGCACTGTGCCTGCTGTG No data
Right 1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG No data
1075512106_1075512112 12 Left 1075512106 10:123081097-123081119 CCTAGGCACTGTGCCTGCTGTGC No data
Right 1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG No data
1075512109_1075512112 -1 Left 1075512109 10:123081110-123081132 CCTGCTGTGCCTGATGGGTATGG No data
Right 1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG No data
1075512111_1075512112 -10 Left 1075512111 10:123081119-123081141 CCTGATGGGTATGGCTGCCCTGA No data
Right 1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075512112 Original CRISPR GCTGCCCTGACCTGTGCTGC AGG Intergenic