ID: 1075512119

View in Genome Browser
Species Human (GRCh38)
Location 10:123081172-123081194
Sequence TTCCCCGGGAGTTTATTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075512111_1075512119 30 Left 1075512111 10:123081119-123081141 CCTGATGGGTATGGCTGCCCTGA No data
Right 1075512119 10:123081172-123081194 TTCCCCGGGAGTTTATTTCAAGG No data
1075512114_1075512119 12 Left 1075512114 10:123081137-123081159 CCTGACCTGTGCTGCAGGATTGA No data
Right 1075512119 10:123081172-123081194 TTCCCCGGGAGTTTATTTCAAGG No data
1075512115_1075512119 7 Left 1075512115 10:123081142-123081164 CCTGTGCTGCAGGATTGAAGTTT No data
Right 1075512119 10:123081172-123081194 TTCCCCGGGAGTTTATTTCAAGG No data
1075512113_1075512119 13 Left 1075512113 10:123081136-123081158 CCCTGACCTGTGCTGCAGGATTG No data
Right 1075512119 10:123081172-123081194 TTCCCCGGGAGTTTATTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075512119 Original CRISPR TTCCCCGGGAGTTTATTTCA AGG Intergenic