ID: 1075514015

View in Genome Browser
Species Human (GRCh38)
Location 10:123094974-123094996
Sequence CCCAGCCCGGCACTGGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075514015_1075514024 17 Left 1075514015 10:123094974-123094996 CCCAAACCCAGTGCCGGGCTGGG No data
Right 1075514024 10:123095014-123095036 TCTTGCCACAAGCACTACTTTGG No data
1075514015_1075514026 19 Left 1075514015 10:123094974-123094996 CCCAAACCCAGTGCCGGGCTGGG No data
Right 1075514026 10:123095016-123095038 TTGCCACAAGCACTACTTTGGGG No data
1075514015_1075514022 -10 Left 1075514015 10:123094974-123094996 CCCAAACCCAGTGCCGGGCTGGG No data
Right 1075514022 10:123094987-123095009 CCGGGCTGGGGAACAGTGTGTGG No data
1075514015_1075514025 18 Left 1075514015 10:123094974-123094996 CCCAAACCCAGTGCCGGGCTGGG No data
Right 1075514025 10:123095015-123095037 CTTGCCACAAGCACTACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075514015 Original CRISPR CCCAGCCCGGCACTGGGTTT GGG (reversed) Intergenic
No off target data available for this crispr