ID: 1075519566

View in Genome Browser
Species Human (GRCh38)
Location 10:123135814-123135836
Sequence CGGCCCTGCCGCGGCACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075519566_1075519583 25 Left 1075519566 10:123135814-123135836 CCCTCGGTGCCGCGGCAGGGCCG 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1075519583 10:123135862-123135884 TCATGCGAGCCCGCCCGTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1075519566_1075519582 24 Left 1075519566 10:123135814-123135836 CCCTCGGTGCCGCGGCAGGGCCG 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1075519582 10:123135861-123135883 CTCATGCGAGCCCGCCCGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075519566 Original CRISPR CGGCCCTGCCGCGGCACCGA GGG (reversed) Intergenic
900574198 1:3374946-3374968 CAGCCCTGCCCGGACACCGAAGG - Intronic
900658836 1:3772920-3772942 CGGCCCTGGCCCCGCACCGCGGG - Intronic
900671340 1:3856913-3856935 TGGCGCTGCCGCGGCCCCGGTGG + Exonic
901066662 1:6497504-6497526 CGGCCGGGCCTCGGCGCCGACGG + Intronic
901835233 1:11919812-11919834 CGGCCCAGCCTCGGGACCGTGGG + Exonic
907038418 1:51236599-51236621 CGGCCCCTCGGCGGCACCGTGGG + Exonic
921162637 1:212483979-212484001 CTGCCCTGCCGCTGAACCCAAGG - Intergenic
922674492 1:227542328-227542350 CGGCCCGGCCGCGTCGCCCAGGG - Intergenic
922695453 1:227728848-227728870 AGGCCCTGCCGCGGAGCCGAAGG + Intronic
1066281701 10:33924036-33924058 CGGCCCTGCAGCAGCATCTAAGG - Intergenic
1073297679 10:102450886-102450908 CGGCCCCGCCGCGCCACCCGAGG - Exonic
1075519566 10:123135814-123135836 CGGCCCTGCCGCGGCACCGAGGG - Intergenic
1077557472 11:3232527-3232549 CGGCCCCTCCGAGGCACAGATGG - Intergenic
1078659866 11:13278003-13278025 CGCCCCTGCCGCCGCCCCGGGGG + Intronic
1083478209 11:62927240-62927262 CGCCCCTGCCGCGGCCCCTAGGG + Intergenic
1083747230 11:64743143-64743165 CGGCCTTCCCGCGACTCCGAGGG - Intronic
1089100536 11:115958817-115958839 CTGCCCGGCCCCGCCACCGAAGG - Intergenic
1089100837 11:115961274-115961296 CAGCCCTGCCGCTGCAACGGAGG + Intergenic
1091266662 11:134276716-134276738 CGGCCAGGCCGAGGCGCCGAGGG - Intronic
1091671467 12:2455019-2455041 CGGCCCTGCCCCTGCACGGGTGG + Intronic
1105071432 12:133236191-133236213 CCGCCCTGCAGCGGAGCCGAGGG + Intergenic
1107605107 13:42048853-42048875 CGGCCCCGCCGAGGCAGCGGCGG - Exonic
1112077714 13:95931525-95931547 CCACCCTGCCCCGGCACCGTGGG - Intronic
1112956100 13:105059928-105059950 CAGCCCTGCAGCAGCACCTAGGG - Intergenic
1113837512 13:113338105-113338127 GGGCCCTGCCGCGTGACTGAGGG - Intronic
1113861588 13:113490756-113490778 CGGCACTGCCCCGGAGCCGAGGG - Exonic
1113984686 13:114304161-114304183 CAGCCCTGCCCCAGCACTGAAGG - Intronic
1117424553 14:55580614-55580636 CGGCTCTGTCGCGGCACCCGGGG + Intronic
1122445061 14:101761929-101761951 GGGCCCGGCCGCGGGACGGAGGG + Intronic
1123067603 14:105626419-105626441 CGTCCCTGAGGTGGCACCGATGG - Intergenic
1123071622 14:105645144-105645166 CGTCCCTGAGGTGGCACCGATGG - Intergenic
1123091282 14:105743420-105743442 CGTCCCTGAGGTGGCACCGATGG - Intergenic
1123097056 14:105771760-105771782 CGTCCCTGAGGTGGCACCGATGG - Intergenic
1124378089 15:29141266-29141288 GGGCCCTGCCTGGGCACTGAGGG + Intronic
1132831863 16:1932392-1932414 CGGCTCTGCTGCGGCAGGGAGGG - Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1136410793 16:30075975-30075997 CGGCCCCGCCGCGGAAGCAAAGG - Exonic
1138590461 16:57996748-57996770 CAGACCTGCAGCGGCACCGGCGG - Exonic
1142136542 16:88454232-88454254 CGGCTCTGCGACGGCACCGGTGG - Intronic
1143109077 17:4543522-4543544 CGGCCCTGCAGGGCCACAGAGGG - Intronic
1143977152 17:10838292-10838314 CTGCCCTGCCCAGGCACCAACGG - Exonic
1147184244 17:38705181-38705203 CTGCCCGGCCGCGGCAGCCATGG - Intergenic
1151576341 17:74954253-74954275 AGGCCCTGCAGCGGCGCCGGCGG - Exonic
1156331653 18:36129263-36129285 CGGCGCTGCCCCCGGACCGAGGG - Exonic
1161084592 19:2328915-2328937 CGGCCGAGCCCCGGCACCGCCGG - Intronic
1161363711 19:3867060-3867082 CGGCACTGCCGCTCCACCGCGGG + Intronic
1161487524 19:4543914-4543936 CGGCCCGGCCGCGCCTCCCACGG - Exonic
1165888898 19:39098991-39099013 GGGCCCTGAAGCGGAACCGACGG - Exonic
1166571082 19:43797769-43797791 CGGCCCTCCTGCACCACCGAGGG - Exonic
1167148250 19:47695049-47695071 CGCCCCCGCCCCGGCACCCATGG + Exonic
1167578483 19:50328923-50328945 CGGCCCCGCCGCGTCCCCGGCGG - Exonic
1168069729 19:53942803-53942825 CGGCCCTCCCACTGCACCGGAGG - Exonic
926320651 2:11746578-11746600 CGCCCCTGCCCCGCCCCCGAAGG + Intronic
927811943 2:26185203-26185225 CGGCGGTCCCGCGGCCCCGAAGG - Exonic
934079042 2:88452263-88452285 GGGCCCGGCCGCGGCCCCGGGGG + Exonic
935775134 2:106466350-106466372 CGGCCCGGCGGCGGCCTCGATGG - Intronic
935775158 2:106466440-106466462 CGGCCCAGCGGCGGCCTCGATGG - Intronic
935775180 2:106466530-106466552 TGGCCCTGCGGCGGCCTCGATGG - Intronic
935775215 2:106466688-106466710 CGGCCCGGCGGCGGCCTCGATGG - Intronic
935775238 2:106466778-106466800 CGGCCCTGCGGCGGCCTCGATGG - Intronic
935775260 2:106466868-106466890 CGGCCCGGCGGCGGCCTCGATGG - Intronic
935775284 2:106466958-106466980 TGGCCCTGCGGCGGCCTCGATGG - Intronic
935775313 2:106467079-106467101 TGGCCCTGCGGCGGCCTCGATGG - Intronic
935775348 2:106467237-106467259 CGGCCCGGCGGCGGCCTCGATGG - Intronic
935775371 2:106467327-106467349 TGGCCCTGCGGCGGCCTCGATGG - Intronic
935775392 2:106467417-106467439 CGGCCCGGCGGCGGCCTCGATGG - Intronic
935775415 2:106467507-106467529 CGGCCCAGCGGCGGCCTCGATGG - Intronic
935775501 2:106467867-106467889 TGGCCCTGCGGCGGCCTCGATGG - Intronic
935775522 2:106467957-106467979 TGGCCCTGCGGCGGCCTCGATGG - Intronic
935775543 2:106468047-106468069 TGGCCCTGCGGCGGCCTCGATGG - Intronic
935775563 2:106468137-106468159 CGGCCCGGCGGCGGCCTCGATGG - Intronic
935904344 2:107827236-107827258 CGGCCCGGCGGCGGCCTCGATGG + Intronic
935904367 2:107827326-107827348 CGGCCCGGCGGCGGCCTCGATGG + Intronic
935904389 2:107827416-107827438 CGGCCCGGCCGCGGCCGCGATGG + Intronic
935904488 2:107827801-107827823 CGGCCCGGCGGCGGCCTCGATGG + Intronic
935904540 2:107828006-107828028 CGGCCCGGCGGCGGCCGCGATGG + Intronic
935904623 2:107828326-107828348 CGGCCCGGCGGCGGCCTCGATGG + Intronic
935904645 2:107828416-107828438 CGGCCCCGCGGCGGCCTCGATGG + Intronic
935904669 2:107828506-107828528 CGGCCCGGCGGCGGCCTCGATGG + Intronic
935904750 2:107828826-107828848 CGGCCCGGCGGCGGCCTCGATGG + Intronic
935904772 2:107828916-107828938 CGGCCCCGCGGCGGCCTCGATGG + Intronic
935904796 2:107829006-107829028 CGGCCCGGCGGCGGCCTCGATGG + Intronic
935904819 2:107829096-107829118 CGGCCCGGCGGCGGCCTCGATGG + Intronic
936427326 2:112432941-112432963 CGGCCCGGCGGCGGCCTCGATGG - Intronic
936427380 2:112433119-112433141 CGGCCCGGCGGCGGCCTCGATGG - Intronic
936427406 2:112433209-112433231 CGGCCCGGCGGCGGCCTCGATGG - Intronic
936427433 2:112433299-112433321 CGGCCCGGCGGCGGCCTCGATGG - Intronic
937883142 2:126883196-126883218 CGGCCCTGCCATGGCAACAAGGG + Intergenic
942105539 2:172629764-172629786 CGGGCCTGCAGCAGCACCTAGGG - Intergenic
1172273382 20:33667052-33667074 CGGCCCAGCCGCGGGGCTGAAGG - Exonic
1175737402 20:61396706-61396728 GGGCCCTGCGGAGGCCCCGAAGG + Intronic
1176021229 20:62963391-62963413 CGGCCCTGCCGCTGCTCCAAGGG - Intronic
1176221136 20:63969823-63969845 CGGCCCGGCCGCAGCCCCGCTGG - Intronic
1176232335 20:64038794-64038816 AGGCTCTGCCGCGGCCCCGCTGG - Intronic
1176236018 20:64053914-64053936 CGGCCCTGCAGCCGCCCCCAGGG - Intronic
1179437278 21:41370406-41370428 GGGCCCTCCCGTGGCACCGTTGG + Intronic
950773587 3:15331914-15331936 CTGCCCGGCCGCGGCACCGCGGG - Intronic
952382989 3:32818626-32818648 CGGCCCTGCCGCTTCCCCGTCGG + Exonic
957297864 3:78355262-78355284 CGGCCCTGCAGCAGCATCTAGGG + Intergenic
964118973 3:153162651-153162673 CGCGCCTGCCGCGGCCCCGTCGG - Exonic
965590435 3:170356988-170357010 CGGCCCAGCTGCGGCCCCGCAGG + Intergenic
968556372 4:1248287-1248309 GGGCCCTCCCGCGTCACCGCCGG + Intronic
968616342 4:1579302-1579324 GGGCCCTGCCGCTGCGCCCACGG + Intergenic
975689525 4:76950028-76950050 CGGCCCCGCGGCGGCGGCGACGG + Intronic
984734781 4:183099107-183099129 CGGCGCTGCCGCGGCAGCGGCGG - Intergenic
990545454 5:56816408-56816430 CGGCCCTGCGGCGGCGCCCCCGG + Intronic
995121160 5:108536440-108536462 CGGCCCTGCGGCAGCACCTAGGG - Intergenic
998130872 5:139650472-139650494 CGGCCCTGGGGCGGCTCCGGCGG - Intronic
1001773444 5:174312114-174312136 CGGCCCAGCGGCGGCATCGGAGG + Intergenic
1012410152 6:98947736-98947758 CGGCCCCGCCCCGGCGCCAAAGG + Intronic
1020107635 7:5429465-5429487 CAGCCCTGCCGCGGCGCCCCAGG + Intergenic
1020288779 7:6706640-6706662 CGGCCCGGCCCCGGCTCCGCAGG - Exonic
1021717627 7:23474017-23474039 GGGCCCTGCCGCGGGACCGCGGG + Intergenic
1022285964 7:28956535-28956557 CGGGCCCGCGGCGGCAGCGACGG + Exonic
1022989598 7:35694833-35694855 CGGCCCTGCCTGGGCGCGGAGGG - Exonic
1029607233 7:101606353-101606375 CGGGCCTGCCCCGGCGCCGCCGG - Intergenic
1034977819 7:155458298-155458320 CGGCCCTCCCGCGGCGCACACGG - Exonic
1042238756 8:66641048-66641070 CGGCCCTGCAGCAGCATCTAGGG - Intronic
1049409178 8:142464861-142464883 CGGCCCTGCCGCGGGACCCCTGG + Exonic
1049572776 8:143377487-143377509 CGGCCCTGCCCTGGGACCAAGGG + Intronic
1054835666 9:69672607-69672629 CGCCCCTGCCCCGGCGCCGGTGG + Intergenic
1059176733 9:112175143-112175165 CGGCGCTCCCGCGGCGCCGCGGG + Exonic
1059191865 9:112333939-112333961 CCGCCCTCCCGCGGCCCCGCGGG + Intergenic
1061275825 9:129568977-129568999 CGGCCCCGCGGCCCCACCGAGGG + Intergenic
1061289489 9:129642454-129642476 CGGCCCTGCCGCTGCCCCACTGG + Intergenic
1200146355 X:153928222-153928244 CGGCCGCGCCCCGGCACCGGTGG - Intronic
1200163264 X:154019809-154019831 CGGCCCGGCGGCGGCAGCCATGG - Exonic