ID: 1075519872

View in Genome Browser
Species Human (GRCh38)
Location 10:123136876-123136898
Sequence GAGAAGGGACGCCGAGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075519872_1075519881 7 Left 1075519872 10:123136876-123136898 CCCAGGACTCGGCGTCCCTTCTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1075519881 10:123136906-123136928 GCCGAGAAGGAGGCAGCCCGCGG 0: 1
1: 0
2: 0
3: 20
4: 242
1075519872_1075519885 18 Left 1075519872 10:123136876-123136898 CCCAGGACTCGGCGTCCCTTCTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1075519885 10:123136917-123136939 GGCAGCCCGCGGGAATGGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 231
1075519872_1075519883 8 Left 1075519872 10:123136876-123136898 CCCAGGACTCGGCGTCCCTTCTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1075519883 10:123136907-123136929 CCGAGAAGGAGGCAGCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 131
1075519872_1075519877 -6 Left 1075519872 10:123136876-123136898 CCCAGGACTCGGCGTCCCTTCTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1075519877 10:123136893-123136915 CTTCTCTGGCCCAGCCGAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 150
1075519872_1075519888 26 Left 1075519872 10:123136876-123136898 CCCAGGACTCGGCGTCCCTTCTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1075519888 10:123136925-123136947 GCGGGAATGGTGAGGCCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 153
1075519872_1075519884 13 Left 1075519872 10:123136876-123136898 CCCAGGACTCGGCGTCCCTTCTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1075519884 10:123136912-123136934 AAGGAGGCAGCCCGCGGGAATGG 0: 1
1: 0
2: 0
3: 14
4: 166
1075519872_1075519878 -3 Left 1075519872 10:123136876-123136898 CCCAGGACTCGGCGTCCCTTCTC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1075519878 10:123136896-123136918 CTCTGGCCCAGCCGAGAAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075519872 Original CRISPR GAGAAGGGACGCCGAGTCCT GGG (reversed) Intronic
901657402 1:10777309-10777331 GAGAGGGGCGTCCGAGTCCTGGG + Intronic
904825017 1:33268697-33268719 GAGAAGGGAAGCAGAACCCTGGG + Intronic
908299857 1:62753304-62753326 GAGAGTGGACGCCGAGGCCAAGG - Intergenic
911502288 1:98702962-98702984 GAGGGGGGATGCAGAGTCCTTGG - Intronic
913646317 1:120858759-120858781 GAGCAGGGACACCGAGACATTGG - Intergenic
914080327 1:144404121-144404143 GAGCAGGGACACCGAGACATTGG + Intergenic
914175235 1:145272645-145272667 GAGCAGGGACACCGAGACATTGG + Intergenic
914529960 1:148514128-148514150 GAGCAGGGACACCGAGACATTGG + Intergenic
915076134 1:153309317-153309339 GAGAAGGGAAACCAAGTCTTAGG + Intronic
919925245 1:202188721-202188743 GAGAAGGGACACCGAACACTTGG - Intergenic
921039698 1:211417845-211417867 GAGAAGAGAATCCGAATCCTGGG + Intergenic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
923293287 1:232568252-232568274 GAGAAAGGAAGGAGAGTCCTGGG + Intergenic
1063944878 10:11166185-11166207 AAGAAGGGACACCCATTCCTGGG + Intronic
1064742803 10:18450513-18450535 GAGAAGGAACACCCAGTCCTGGG - Intronic
1068216600 10:53990683-53990705 CAGAGTGGACGCCGAGTCCGAGG - Intronic
1073196568 10:101695737-101695759 AAGAATGGATGCTGAGTCCTTGG - Intergenic
1075115996 10:119627589-119627611 CAGAAGGGAAGCCGGGTCCAAGG + Intergenic
1075519872 10:123136876-123136898 GAGAAGGGACGCCGAGTCCTGGG - Intronic
1075704959 10:124494967-124494989 GTGAGGGGACACCGGGTCCTGGG - Intronic
1083618140 11:64036300-64036322 GAGATGGGACGCCCAGCCTTTGG + Intronic
1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG + Exonic
1084674863 11:70628423-70628445 GAGCAGGGAAACCGAGGCCTGGG - Intronic
1084751092 11:71204880-71204902 GGGAAGGGACGCCTGGTCCCAGG + Intronic
1084810254 11:71607611-71607633 GAGGAGGGAGGCTGAGTCCGTGG - Intergenic
1084948568 11:72652234-72652256 GAGAAGGGACTCTGTCTCCTGGG - Intronic
1085332840 11:75667797-75667819 GAGAATGGGCGCCGACGCCTGGG + Exonic
1088522568 11:110714762-110714784 GAGAAGGCAAGGCGAGTTCTTGG - Intergenic
1094635808 12:32226652-32226674 GAGAAGGGTCGCTGAAGCCTGGG - Intronic
1096538848 12:52291854-52291876 GAGAAGGGAGGCCAGGTGCTGGG + Intronic
1097201511 12:57282798-57282820 GAGAAGGGCAGCAGAGACCTAGG + Intronic
1104935089 12:132360201-132360223 GAGAAGGGCGGCCGGGTCCCCGG + Intergenic
1106220943 13:27745766-27745788 GAGAAGAGCCGCACAGTCCTGGG - Intergenic
1108714291 13:53063749-53063771 GAGAAGGGAAGCCAAGTGCCTGG - Intergenic
1114270945 14:21099574-21099596 GAGGAGGGAGGCAGGGTCCTGGG - Intronic
1119335101 14:73826811-73826833 GAGAAGGGGCACAGAGTGCTAGG - Intergenic
1120003762 14:79333539-79333561 GAGAAGGGCCGCTGAAGCCTGGG + Intronic
1120012970 14:79437999-79438021 GAGAAGCCACGCTGAGGCCTGGG - Intronic
1129869213 15:78930012-78930034 GAGAAGGGACGGGGATTGCTGGG - Intronic
1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG + Intergenic
1131258640 15:90877227-90877249 GAGAAGGGAGGCAGAGACCGGGG - Intronic
1132186585 15:99806586-99806608 GGGAAGGGGCACCGAGGCCTCGG - Intergenic
1132429101 15:101746125-101746147 GGGAAGGGGCACCGAGGCCTCGG + Intergenic
1136519623 16:30787119-30787141 GAGAAGGACCCCAGAGTCCTCGG - Exonic
1136613646 16:31382174-31382196 GAGAAGGGAGACTGAGGCCTGGG - Intronic
1136990739 16:35149964-35149986 GGGAAGGGAGGCCTGGTCCTAGG - Intergenic
1138509643 16:57500918-57500940 GCGAAGGGAGGCCAAGTGCTTGG + Intergenic
1141679357 16:85535387-85535409 GAGAAGGAAGGCCGAGGCCAGGG - Intergenic
1142311412 16:89316316-89316338 GAGGGGAGACGCCGAGTTCTGGG - Intronic
1145960921 17:28886145-28886167 GAGAAGAGACCCAGAGGCCTCGG - Intronic
1146679212 17:34794982-34795004 GAGAAGGGACTCCAAATCCCTGG - Intergenic
1146928014 17:36758297-36758319 GAGAAGGGAGGGTGGGTCCTAGG + Intergenic
1147997952 17:44371573-44371595 GAGAAGGCAGGCTGTGTCCTTGG - Intergenic
1151662410 17:75525779-75525801 GCCGAGGGACGCCGAGGCCTCGG + Exonic
1156922190 18:42535328-42535350 GAGAATGGATGCCAAGTTCTGGG - Intergenic
1157586364 18:48803931-48803953 GAGAAGGGAGGACCAGCCCTGGG + Intronic
1159159862 18:64629871-64629893 GAGATGGGACGCCAAGTCCCTGG + Intergenic
1160339377 18:78074619-78074641 GAGATGGGAACCTGAGTCCTGGG + Intergenic
1161196851 19:2991645-2991667 GAGAAGGGAGGCTGAGGGCTGGG + Intronic
1163002763 19:14379081-14379103 GAGAAGGGACGTTGAGCCCTGGG + Intergenic
1163063988 19:14779658-14779680 GAGAAGGGACGTTGAGCCCTGGG - Intergenic
1163453125 19:17390794-17390816 GAGAACGGATGCCGGATCCTGGG - Intergenic
1163809610 19:19422463-19422485 CAGAAGGGACACCGAGGCTTGGG - Intronic
1166270686 19:41711643-41711665 GCCAAGGGACTCCTAGTCCTGGG + Intronic
1167105954 19:47429961-47429983 GAGAAGGGAGGCCGAGTCCCAGG + Exonic
1167247894 19:48384784-48384806 GAGAACGGACTGCGAATCCTTGG - Intronic
1167351660 19:48978873-48978895 GAGCAGGGAAGCCGTGCCCTGGG + Intronic
925045101 2:766949-766971 CACAAGGGACACCAAGTCCTGGG + Intergenic
933707689 2:85304099-85304121 GGGCAGGGAGGCCTAGTCCTGGG - Intronic
934490852 2:94761288-94761310 GGGAGGGGAGGCCTAGTCCTAGG - Intergenic
938315867 2:130327754-130327776 CAGAAGGGACGCCGAGGCCAAGG - Intergenic
948348860 2:237322035-237322057 AAGAAAGGACACAGAGTCCTTGG + Intergenic
948661305 2:239508173-239508195 GAGAAGGGAGGCTGGGTCCCAGG - Intergenic
1169854647 20:10089809-10089831 GAGAAGGGTCTCCCAGTCCATGG - Intergenic
1172596424 20:36154169-36154191 GGGGGAGGACGCCGAGTCCTAGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1175133337 20:56805899-56805921 GAGAAGAGACTCCAGGTCCTTGG - Intergenic
1181064535 22:20299298-20299320 GAGAAGGGGCGGTGGGTCCTGGG + Intergenic
1182346324 22:29668374-29668396 GAGAAGGAAAGCCGATTCTTTGG + Exonic
950421952 3:12904572-12904594 GAGGAGGGAGGCCATGTCCTGGG - Intronic
956615927 3:71172625-71172647 GGGCAGGGACTCCGAATCCTAGG + Intronic
957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
959496045 3:107053094-107053116 GAGAAGGGAAGCAGAGTACCTGG - Intergenic
965503006 3:169478721-169478743 GAGAAGGGATGCCAATTCCTAGG + Intronic
967822781 3:193853718-193853740 GATAAGGGACGCTGAGTTTTAGG + Intergenic
969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
969732206 4:8963995-8964017 GAGGAGGGAGGCTGAGTCCGGGG - Intergenic
971209197 4:24599603-24599625 CAGGAGGGACGCCGAGGCCAAGG + Intergenic
971405859 4:26320612-26320634 GAGAAGGGAGGAGGGGTCCTGGG - Intronic
975871054 4:78778561-78778583 TAGAAGGGAGGCCAAGGCCTAGG + Intronic
984984094 4:185310727-185310749 GAGAAGAGAATCCGAATCCTGGG + Exonic
992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG + Intronic
1001457122 5:171872429-171872451 AAGCAGGGAGGCCGAGTGCTGGG + Intronic
1002929785 6:1625073-1625095 TAGAGGGGTCCCCGAGTCCTGGG - Intronic
1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG + Intergenic
1006497966 6:34437492-34437514 CAGAGTGGACGCCGAGGCCTAGG + Intergenic
1007774863 6:44219416-44219438 GAGAAGGGGGTCCGAGCCCTTGG + Intergenic
1008569875 6:52806358-52806380 GAGGAGAGATGCTGAGTCCTGGG + Intergenic
1008845400 6:55957373-55957395 GAGAAGAAACCCCGAGTGCTGGG + Intergenic
1009799251 6:68512791-68512813 GAGAATGGAAGCCAAGCCCTTGG - Intergenic
1010428087 6:75748826-75748848 GAGAAGGGGCGAGGAGTCCGGGG - Intergenic
1011742515 6:90376509-90376531 GCGAAGGCACTCCAAGTCCTGGG - Intergenic
1012581994 6:100881008-100881030 GAGAAGGGTCGCCGCGGCCAGGG - Intronic
1016349471 6:143151806-143151828 CAGAAGGGAAGCCGAATTCTGGG + Intronic
1021614470 7:22488121-22488143 GAGAAGGGACTCGGAGGACTGGG - Intronic
1025145176 7:56495654-56495676 GAAAAGGGAGGCCCAGTCCTAGG - Intergenic
1025260778 7:57416146-57416168 GGGAAGGGAGGCCCAGTCCTAGG - Intergenic
1025983691 7:66428997-66429019 GAGAGGGGACTCGGAGTCCCAGG - Intergenic
1026031504 7:66798361-66798383 GAGAAGGGACTCGGAGTCCCAGG + Intronic
1039899500 8:41741087-41741109 GAGGAGGGAAGCCCAGTTCTGGG - Intronic
1045354373 8:101372341-101372363 GAGAAGGGAAGCTGAGTGCCTGG + Intergenic
1051100583 9:13516370-13516392 GAGAAGGGACTCCTACTACTAGG - Intergenic
1053667142 9:40324400-40324422 GGGAGGGGAGGCCTAGTCCTAGG + Intronic
1053916732 9:42949511-42949533 GGGAGGGGAGGCCTAGTCCTAGG + Intergenic
1054378288 9:64464428-64464450 GGGAGGGGAGGCCTAGTCCTAGG + Intergenic
1054517468 9:66051883-66051905 GGGAGGGGAGGCCTAGTCCTAGG - Intergenic
1056500052 9:87199893-87199915 GAGAAGGGAAGGAGAGCCCTGGG - Intergenic
1057014794 9:91642234-91642256 GAGAGGGGATGCTGGGTCCTGGG + Intronic
1061964394 9:134004868-134004890 GAGAAGGGAAGCCGTGGGCTGGG - Intergenic
1200266746 X:154650251-154650273 GAGAGAGGACGCTGAGACCTGGG - Intergenic
1201499650 Y:14627786-14627808 TGGAATGGACGCCGAGGCCTAGG + Intronic