ID: 1075520649

View in Genome Browser
Species Human (GRCh38)
Location 10:123141758-123141780
Sequence TCTCTTTGGGTGATGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075520649_1075520653 0 Left 1075520649 10:123141758-123141780 CCTTTCTGCATCACCCAAAGAGA No data
Right 1075520653 10:123141781-123141803 CACACATGGAAACAACACACAGG No data
1075520649_1075520654 3 Left 1075520649 10:123141758-123141780 CCTTTCTGCATCACCCAAAGAGA No data
Right 1075520654 10:123141784-123141806 ACATGGAAACAACACACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075520649 Original CRISPR TCTCTTTGGGTGATGCAGAA AGG (reversed) Intergenic
No off target data available for this crispr