ID: 1075521934

View in Genome Browser
Species Human (GRCh38)
Location 10:123148412-123148434
Sequence CTGGAGACGCCACCGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 103}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075521934_1075521939 4 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521939 10:123148439-123148461 ACCATCCAGTCCATCCTGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 166
1075521934_1075521938 1 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521938 10:123148436-123148458 TTCACCATCCAGTCCATCCTGGG 0: 1
1: 0
2: 0
3: 23
4: 249
1075521934_1075521943 7 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521943 10:123148442-123148464 ATCCAGTCCATCCTGGGCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 183
1075521934_1075521950 27 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521950 10:123148462-123148484 GGGCCCCTCGGAGGCACCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 191
1075521934_1075521948 18 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521948 10:123148453-123148475 CCTGGGCGGGGGCCCCTCGGAGG 0: 1
1: 0
2: 4
3: 32
4: 342
1075521934_1075521949 26 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521949 10:123148461-123148483 GGGGCCCCTCGGAGGCACCGCGG 0: 1
1: 0
2: 1
3: 15
4: 205
1075521934_1075521941 5 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521941 10:123148440-123148462 CCATCCAGTCCATCCTGGGCGGG 0: 1
1: 0
2: 0
3: 20
4: 193
1075521934_1075521942 6 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521942 10:123148441-123148463 CATCCAGTCCATCCTGGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1075521934_1075521937 0 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521937 10:123148435-123148457 CTTCACCATCCAGTCCATCCTGG 0: 1
1: 0
2: 1
3: 16
4: 201
1075521934_1075521946 15 Left 1075521934 10:123148412-123148434 CCGGCGGCCGGTGGCGTCTCCAG 0: 1
1: 0
2: 3
3: 10
4: 103
Right 1075521946 10:123148450-123148472 CATCCTGGGCGGGGGCCCCTCGG 0: 1
1: 0
2: 2
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075521934 Original CRISPR CTGGAGACGCCACCGGCCGC CGG (reversed) Exonic
900094782 1:935941-935963 GTGGAGACGCCACCGTCCTCTGG - Intronic
900538487 1:3190908-3190930 CTGGGGAGGCCACCTGCCCCCGG + Intronic
901709048 1:11099672-11099694 CAGGAGTCGCCCGCGGCCGCCGG - Intronic
906319199 1:44806268-44806290 CTGGAGGCGGCGCTGGCCGCAGG - Exonic
922293361 1:224227617-224227639 CTGGAGACATCACCGGCTGAGGG + Exonic
923036250 1:230287109-230287131 CTGGAGTCGCCTCCGCCCGCCGG + Intergenic
923119663 1:230978607-230978629 CTGCAGCCGCCGCCGCCCGCCGG + Exonic
923296642 1:232600995-232601017 CTTGAGACACCACTGGCCACAGG - Intergenic
1062893680 10:1086385-1086407 CTGGAGAAGGCAACGGCCTCTGG - Intronic
1065323224 10:24528050-24528072 CTGGAGATGCCGCCAGCCACAGG + Exonic
1067705657 10:48604904-48604926 CGGGTGACGCCAGCGGCCACGGG - Exonic
1072283752 10:93893993-93894015 CGCCAGACGGCACCGGCCGCTGG + Exonic
1073425323 10:103452285-103452307 CTGAAGCCGCCACCAGCCCCAGG - Exonic
1075375515 10:121975139-121975161 CTGGGGACAGCAGCGGCCGCGGG - Exonic
1075521934 10:123148412-123148434 CTGGAGACGCCACCGGCCGCCGG - Exonic
1083048209 11:59755251-59755273 TTGGAGACGCCCCGGGCGGCCGG + Exonic
1085052718 11:73388064-73388086 CTGGAGAAGCCTCCGGCCAGTGG - Intronic
1089378783 11:118013123-118013145 CTGGATACGCCACCAGCCTATGG - Intergenic
1089789027 11:120929232-120929254 CTGCCCACGCCACCCGCCGCGGG - Intronic
1092318060 12:7440320-7440342 CTGGAGCCGCCGCCGCCCACCGG + Intronic
1092401118 12:8180224-8180246 CTGGAGACCCGGCCCGCCGCGGG - Intronic
1100854014 12:98742212-98742234 CTGCAGTCGCCACCTTCCGCCGG + Intronic
1105702487 13:22943804-22943826 CTGGAGAAGCCACCAGCTGGTGG - Intergenic
1106879392 13:34112864-34112886 TTGGAGAGGATACCGGCCGCTGG + Intergenic
1107481468 13:40789428-40789450 CGGGAGCCGCCACCGCCCACCGG - Intronic
1113675953 13:112208164-112208186 ATGGAGACGCCACCGGGAGGTGG - Intergenic
1115852664 14:37599864-37599886 CGGGAGACGCGCGCGGCCGCGGG - Intronic
1116099272 14:40411408-40411430 CTGGAGACTCAACTGGCAGCTGG + Intergenic
1120528146 14:85601435-85601457 CTGGGGAGGCCACAGGCCTCTGG + Intronic
1122082389 14:99274617-99274639 CCGGACACGCCGCCGCCCGCCGG + Intergenic
1122346476 14:101064203-101064225 CTGGAGAGGGCTCCGGCTGCAGG - Intergenic
1122860363 14:104579782-104579804 CTGGAGGCGCCACCGCCCGCTGG - Exonic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1124785035 15:32671796-32671818 CCTGAGGCGACACCGGCCGCAGG - Intronic
1130380252 15:83365728-83365750 CTGGAGAAGCGGCCGGACGCAGG - Intergenic
1130986118 15:88845760-88845782 CTGGAGAGGCCACCAGGCCCTGG + Exonic
1132544831 16:528206-528228 CTGGAGGCGCCAGCGGGCGGCGG - Intronic
1132554751 16:567590-567612 CTGGAGACTCCACGGGCTCCCGG + Exonic
1132875470 16:2135224-2135246 CTGCAGACGCCAGCGGGGGCGGG - Intronic
1133126682 16:3651871-3651893 CTGGAGACTCCACAAGCCACAGG + Intronic
1134137925 16:11691992-11692014 CTGGAGCATCCACCCGCCGCAGG + Exonic
1134853484 16:17500722-17500744 CTGGAGAAGCCACTGGCTGGGGG - Intergenic
1136579137 16:31141581-31141603 CTGGAGCAGCCTCCAGCCGCAGG + Exonic
1139957664 16:70700826-70700848 ATGGAGACGGCACCAGCTGCCGG - Intronic
1146183793 17:30712227-30712249 GTGGAGACGCCACCGGCCGGGGG - Intergenic
1146356507 17:32139026-32139048 CTGGAGACAGCACAGGTCGCTGG - Intergenic
1151978873 17:77497691-77497713 CTGGAGACGCCCCACGCTGCCGG - Intronic
1152757781 17:82094152-82094174 CTGGAGAGGCCACTGGCCGACGG - Intronic
1155297303 18:24397447-24397469 CTGGAGCAGCCAGCGGCCGCCGG + Intronic
1158202853 18:54959430-54959452 GTGCAGCCGCCACCGCCCGCAGG + Exonic
1158277139 18:55780551-55780573 CTGGGGACCCAACAGGCCGCCGG + Intergenic
1158489210 18:57894893-57894915 CTGGAGCCGCCACCAGAAGCTGG + Intergenic
1159045596 18:63366753-63366775 CGGGGGACCCCGCCGGCCGCAGG - Intronic
1160586772 18:79917547-79917569 CTGGGGACGCCACACTCCGCCGG + Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1163633750 19:18429279-18429301 CTGGAGACGCCAAGGTCGGCAGG - Intronic
1163779480 19:19239110-19239132 CAGGAGACGCCAGTGGGCGCTGG - Intronic
1165129335 19:33622257-33622279 CTGGAGGCGCCCGCGGCCTCGGG + Intronic
1165751819 19:38264849-38264871 CAGGCGACGCCACCAGCCGTTGG - Exonic
1168495031 19:56840642-56840664 CTGGTGGCGCCGCCGGGCGCCGG - Exonic
925572364 2:5325686-5325708 CGGGAGACGCCAGCAGACGCCGG - Intergenic
927502621 2:23592512-23592534 CTGGAGAGGCCCCCGGCCTGCGG - Intronic
928919599 2:36512893-36512915 CTGGAGAAGCCTCAGGCAGCAGG - Intronic
929787177 2:45001343-45001365 CTGGAGCCGCTGCCGGCGGCCGG - Intergenic
936163862 2:110103672-110103694 CTGAAGGAGCCACCGGCTGCTGG - Intronic
941929972 2:170929438-170929460 CTGGAGGCGGGGCCGGCCGCGGG + Intronic
942083922 2:172427449-172427471 CTGGAGACGCCAGAGCCGGCGGG + Intronic
948983773 2:241508225-241508247 CAGGAGACCCCCCAGGCCGCCGG + Intronic
949012108 2:241686793-241686815 GTGGAGACGCCAGCGGCGGGCGG - Exonic
949046484 2:241874725-241874747 ATGGAGACCCCAGCGGCCCCAGG + Intergenic
1169164018 20:3407394-3407416 CCGGCGACGCCTCCCGCCGCAGG - Intronic
1181934561 22:26429431-26429453 CAGGAGACGCCGCCGCCCGAGGG - Exonic
1185205695 22:49536763-49536785 CAGGAGACGCCGCCGTCCCCGGG - Intronic
1185214400 22:49590147-49590169 CTGGACGCTCCACCTGCCGCCGG - Intronic
1185267260 22:49910917-49910939 CTGGAGATGCCACAGCCCGGTGG - Intronic
950495502 3:13331715-13331737 CGGGAGACTCCACGGGCCACAGG - Intronic
968477285 4:817962-817984 CTGGAGGCGCCACCGCCCTCGGG + Intronic
969574685 4:8030047-8030069 CTGGAGCCCCCACCGGCAGGAGG - Intronic
969778996 4:9381356-9381378 CTGGAGACCCGGCCCGCCGCGGG + Intergenic
972312064 4:37891104-37891126 CTGGTGCCGCCACCGTCCGCCGG + Exonic
974674146 4:65069242-65069264 CTGCTGACGCCACCTGCCTCTGG - Intergenic
978385506 4:108172606-108172628 CTACAGACGCCAACGGGCGCCGG - Intergenic
985644205 5:1077460-1077482 CTGGTGACGCCACCTCCCACGGG + Intronic
985658336 5:1143397-1143419 CAGGAGAAGCCACCGTCTGCGGG - Intergenic
994072878 5:95621049-95621071 CTGGTGGCGGCACCGGCCGCAGG + Exonic
995551495 5:113286191-113286213 CTGGAGACACCGGGGGCCGCTGG + Intronic
1001581298 5:172800288-172800310 CTGGAGATTCCACCAGCCCCAGG + Intergenic
1005503777 6:26452250-26452272 CTGGAGACACCACTGACCCCGGG + Exonic
1007760110 6:44128274-44128296 CTGGAGAGGCGGCCGGCCCCGGG + Intronic
1012450724 6:99350039-99350061 CAGGAGACGCCACCAGGCGGGGG + Intronic
1014233977 6:118935022-118935044 CTCGAGGCGCCACCGGCCGCGGG + Exonic
1018398799 6:163402048-163402070 CTGGAGACGCCATAGGACACAGG + Intergenic
1020213253 7:6170794-6170816 CTGCAGACGGCAGCGGCCGCGGG + Intronic
1034617904 7:152435479-152435501 CGGGAGCCGCCACCGCCCGCGGG + Intronic
1035775772 8:2186907-2186929 CTGGCGACCCCACCTGCCCCTGG - Intergenic
1036276436 8:7355315-7355337 CTGGAGACCCGGCCCGCCGCGGG + Intergenic
1036344905 8:7955030-7955052 CTGGAGACCCGGCCCGCCGCGGG - Intergenic
1036840244 8:12115797-12115819 CTGGAGACCCGGCCCGCCGCGGG - Intergenic
1036862034 8:12362034-12362056 CTGGAGACCCGGCCCGCCGCGGG - Intergenic
1037837297 8:22221725-22221747 CTGGAAGCGCCAGCGGCCGTAGG + Exonic
1049347477 8:142146566-142146588 CGGGAGACGCCTCCGCCCTCGGG + Intergenic
1049696054 8:143984846-143984868 CTGCAGACCCCACAGGCCCCAGG + Exonic
1049747618 8:144269716-144269738 CTGCAGAAGCCTCCGCCCGCCGG + Intronic
1051343682 9:16133638-16133660 CTGGAGCCCCCACAGGCAGCTGG + Intergenic
1053010268 9:34628930-34628952 GTGGAGACGCCAGGGGCAGCGGG - Intergenic
1053724838 9:40988758-40988780 CTGGAGACTCCACAGGCGCCAGG + Intergenic
1054341132 9:63863243-63863265 CTGGAGACTCCACAGGCGCCAGG - Intergenic
1057758345 9:97854009-97854031 CAGGGGAGGCCACGGGCCGCGGG + Exonic
1058977379 9:110137426-110137448 CTGGAGACCCCATCGGCAGCAGG + Exonic
1060634423 9:125189202-125189224 CAGGAGATGCCACCGGCTACCGG - Intronic
1062100420 9:134725108-134725130 CCGGAGACGCCACCGTCTCCAGG + Intronic
1062472260 9:136711842-136711864 CTGGAAGCGCCGGCGGCCGCGGG + Intergenic
1062489813 9:136799647-136799669 CTGGAGGAGCCAGCGGCTGCGGG + Intronic
1185641516 X:1591651-1591673 CGGGAGCCGCCACCGTCCCCCGG - Exonic
1186477156 X:9866501-9866523 CTGGACATGTCACCTGCCGCAGG - Intronic
1187933526 X:24314494-24314516 CTGGAGACGCCACAGGCTTGTGG + Intergenic
1196480502 X:116141858-116141880 CTGGAAAAGCCACAGGCAGCTGG + Intergenic