ID: 1075526754

View in Genome Browser
Species Human (GRCh38)
Location 10:123193662-123193684
Sequence GGGCCAAACTGAATTAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075526754_1075526763 10 Left 1075526754 10:123193662-123193684 CCCCTCCTAATTCAGTTTGGCCC No data
Right 1075526763 10:123193695-123193717 AGAAAAGGATTGTAATTAGAGGG No data
1075526754_1075526762 9 Left 1075526754 10:123193662-123193684 CCCCTCCTAATTCAGTTTGGCCC No data
Right 1075526762 10:123193694-123193716 TAGAAAAGGATTGTAATTAGAGG No data
1075526754_1075526758 -5 Left 1075526754 10:123193662-123193684 CCCCTCCTAATTCAGTTTGGCCC No data
Right 1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075526754 Original CRISPR GGGCCAAACTGAATTAGGAG GGG (reversed) Intergenic
No off target data available for this crispr